ID: 1065634492

View in Genome Browser
Species Human (GRCh38)
Location 10:27716809-27716831
Sequence TACCAGGTTGAAAAGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065634492_1065634494 14 Left 1065634492 10:27716809-27716831 CCTCATGACTTTTCAACCTGGTA No data
Right 1065634494 10:27716846-27716868 ATGTTACGTTCCATGTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065634492 Original CRISPR TACCAGGTTGAAAAGTCATG AGG (reversed) Intronic