ID: 1065634762

View in Genome Browser
Species Human (GRCh38)
Location 10:27719871-27719893
Sequence CCTTGGGCCTCGAGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2060
Summary {0: 1, 1: 0, 2: 1, 3: 79, 4: 1979}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065634762_1065634769 9 Left 1065634762 10:27719871-27719893 CCAGCTACTCTCGAGGCCCAAGG 0: 1
1: 0
2: 1
3: 79
4: 1979
Right 1065634769 10:27719903-27719925 TGTTTGAGCCCAGGAGTTTGAGG 0: 124
1: 2264
2: 7850
3: 19063
4: 42081
1065634762_1065634768 0 Left 1065634762 10:27719871-27719893 CCAGCTACTCTCGAGGCCCAAGG 0: 1
1: 0
2: 1
3: 79
4: 1979
Right 1065634768 10:27719894-27719916 TAGGAGGATTGTTTGAGCCCAGG 0: 47
1: 1668
2: 16170
3: 50998
4: 130062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065634762 Original CRISPR CCTTGGGCCTCGAGAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr