ID: 1065638924

View in Genome Browser
Species Human (GRCh38)
Location 10:27760850-27760872
Sequence CACTGACTTGTTGGATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065638916_1065638924 25 Left 1065638916 10:27760802-27760824 CCAAGTTTTTTCCTAATCAATCA No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data
1065638917_1065638924 14 Left 1065638917 10:27760813-27760835 CCTAATCAATCACCATCCCTAAT No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data
1065638919_1065638924 -2 Left 1065638919 10:27760829-27760851 CCCTAATGTTTTTTCATTACACA No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data
1065638920_1065638924 -3 Left 1065638920 10:27760830-27760852 CCTAATGTTTTTTCATTACACAC No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data
1065638915_1065638924 28 Left 1065638915 10:27760799-27760821 CCTCCAAGTTTTTTCCTAATCAA No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data
1065638918_1065638924 2 Left 1065638918 10:27760825-27760847 CCATCCCTAATGTTTTTTCATTA No data
Right 1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065638924 Original CRISPR CACTGACTTGTTGGATGGGC TGG Intergenic
No off target data available for this crispr