ID: 1065639270

View in Genome Browser
Species Human (GRCh38)
Location 10:27765454-27765476
Sequence GGTCATAGTGGCTGAAACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065639270_1065639275 -1 Left 1065639270 10:27765454-27765476 CCCGGGTTTCAGCCACTATGACC No data
Right 1065639275 10:27765476-27765498 CACATTCCAACCAGGAGAAAAGG No data
1065639270_1065639273 -9 Left 1065639270 10:27765454-27765476 CCCGGGTTTCAGCCACTATGACC No data
Right 1065639273 10:27765468-27765490 ACTATGACCACATTCCAACCAGG No data
1065639270_1065639278 10 Left 1065639270 10:27765454-27765476 CCCGGGTTTCAGCCACTATGACC No data
Right 1065639278 10:27765487-27765509 CAGGAGAAAAGGAGAACGAACGG No data
1065639270_1065639279 11 Left 1065639270 10:27765454-27765476 CCCGGGTTTCAGCCACTATGACC No data
Right 1065639279 10:27765488-27765510 AGGAGAAAAGGAGAACGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065639270 Original CRISPR GGTCATAGTGGCTGAAACCC GGG (reversed) Intergenic
No off target data available for this crispr