ID: 1065642079

View in Genome Browser
Species Human (GRCh38)
Location 10:27793595-27793617
Sequence TCTAAGATCTTCAGCCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065642079_1065642081 7 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642081 10:27793625-27793647 GATGAGGACAGAACATGCCAAGG No data
1065642079_1065642085 26 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642085 10:27793644-27793666 AAGGGCTGAGTCATAATGGCAGG No data
1065642079_1065642086 27 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642086 10:27793645-27793667 AGGGCTGAGTCATAATGGCAGGG No data
1065642079_1065642083 22 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642083 10:27793640-27793662 TGCCAAGGGCTGAGTCATAATGG No data
1065642079_1065642080 -9 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642080 10:27793609-27793631 GATCTTAGAGCACAGTGATGAGG No data
1065642079_1065642082 8 Left 1065642079 10:27793595-27793617 CCTAGGAGGCTGAAGATCTTAGA No data
Right 1065642082 10:27793626-27793648 ATGAGGACAGAACATGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065642079 Original CRISPR TCTAAGATCTTCAGCCTCCT AGG (reversed) Intergenic
No off target data available for this crispr