ID: 1065644087

View in Genome Browser
Species Human (GRCh38)
Location 10:27816417-27816439
Sequence CCTAGGATATTGAACGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065644087_1065644089 -10 Left 1065644087 10:27816417-27816439 CCAGCATCGTTCAATATCCTAGG 0: 1
1: 0
2: 1
3: 1
4: 38
Right 1065644089 10:27816430-27816452 ATATCCTAGGCATAACACAGAGG No data
1065644087_1065644091 4 Left 1065644087 10:27816417-27816439 CCAGCATCGTTCAATATCCTAGG 0: 1
1: 0
2: 1
3: 1
4: 38
Right 1065644091 10:27816444-27816466 ACACAGAGGAAATAGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065644087 Original CRISPR CCTAGGATATTGAACGATGC TGG (reversed) Intronic
915028209 1:152853158-152853180 CCTAGGAAATTGAAAGATGCAGG - Intergenic
1065644087 10:27816417-27816439 CCTAGGATATTGAACGATGCTGG - Intronic
1067578655 10:47425040-47425062 CATAGGATATTGCATAATGCTGG + Intergenic
1074760722 10:116665495-116665517 CCTGGGATTTGGAACGGTGCGGG + Intronic
1075591511 10:123694748-123694770 CCTAGGAAGTTGAACGAAGAAGG + Intergenic
1082955193 11:58863389-58863411 CCTAGGATATTGGTAGATGGGGG + Intronic
1085263558 11:75223283-75223305 CCTCGGATAGTGAATGCTGCAGG - Intergenic
1088100212 11:106146420-106146442 CCTAGGATATTGGATCTTGCTGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1109967361 13:69718390-69718412 CCTAGAATATTGATCATTGCTGG - Intronic
1110372769 13:74758023-74758045 CTTAGGATATTGAAAGCTACTGG + Intergenic
1111739487 13:92185159-92185181 CCCAGGATATTGAATGACCCTGG - Intronic
1120824755 14:88945148-88945170 CCTGGGAGATTGGAGGATGCTGG + Intergenic
1158203035 18:54960902-54960924 CCTTGGATATTGAAGGATTTGGG - Intergenic
928107060 2:28477345-28477367 CCTAGGATATTCATCTATGTAGG + Intronic
933435911 2:82249704-82249726 CCTAGGATATTGGATCTTGCTGG + Intergenic
933690595 2:85176583-85176605 TCTAGGATAATGAAGGATGAGGG - Intronic
937643718 2:124242547-124242569 CCTAGGAAGTAGAACCATGCCGG - Intronic
1172219814 20:33265960-33265982 CCTAGGCTATTTTATGATGCTGG + Intergenic
1184591942 22:45490782-45490804 CCTAGGATATTGGATCTTGCTGG - Intergenic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
964467323 3:157009403-157009425 GCTACCATATTGAACAATGCAGG + Intronic
965897672 3:173596979-173597001 CCCAGGCTATTGAATGTTGCTGG + Intronic
969490275 4:7495740-7495762 CCTAGGCTCTTGAACAATGCAGG + Intronic
976898972 4:90149771-90149793 CTTAAGATATTTAATGATGCAGG + Intronic
977021770 4:91769055-91769077 CTTAGGATATTGAATCTTGCTGG + Intergenic
991567694 5:68021469-68021491 CCTAGGATTTTTAATGATGTTGG + Intergenic
993472199 5:88319601-88319623 CCTAGAAAATTGAATGAGGCTGG - Intergenic
993687246 5:90953430-90953452 CCTAAAATATTGAACGCTGTGGG - Intronic
994160191 5:96548673-96548695 CCTAGAATTTTCAAGGATGCTGG + Intronic
1015876256 6:137825790-137825812 CTTATGATCTTGAACCATGCTGG + Intergenic
1026007181 7:66609235-66609257 GCTAGGATCTTGGAGGATGCAGG - Intergenic
1033888574 7:145979156-145979178 CCTAGGAGCTTGAAAGAAGCAGG - Intergenic
1037725895 8:21482446-21482468 CCTAGAACATTCAAAGATGCCGG + Intergenic
1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG + Exonic
1051412789 9:16808439-16808461 ACTAGGATATTGATAGATTCAGG - Intronic
1051552686 9:18347682-18347704 CCTAGAATATTGAACTATTTGGG + Intergenic
1187834446 X:23416988-23417010 CCTAGCATATTGAACTATCATGG - Intergenic
1189889016 X:45579179-45579201 CCTACCATATTGATCTATGCTGG + Intergenic
1198242434 X:134798704-134798726 CTTAGGATATTGAATCTTGCTGG + Intronic
1200808662 Y:7459779-7459801 CTTAGGATCTTGGAAGATGCTGG + Intergenic