ID: 1065652206 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:27904190-27904212 |
Sequence | GTGATAGGGCTCCTGCAATG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 104 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 97} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065652202_1065652206 | 29 | Left | 1065652202 | 10:27904138-27904160 | CCTATCAGCTCTGTAAGCATAAA | No data | ||
Right | 1065652206 | 10:27904190-27904212 | GTGATAGGGCTCCTGCAATGTGG | 0: 1 1: 0 2: 0 3: 6 4: 97 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065652206 | Original CRISPR | GTGATAGGGCTCCTGCAATG TGG | Intronic | ||