ID: 1065652206

View in Genome Browser
Species Human (GRCh38)
Location 10:27904190-27904212
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065652202_1065652206 29 Left 1065652202 10:27904138-27904160 CCTATCAGCTCTGTAAGCATAAA No data
Right 1065652206 10:27904190-27904212 GTGATAGGGCTCCTGCAATGTGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type