ID: 1065654582

View in Genome Browser
Species Human (GRCh38)
Location 10:27934951-27934973
Sequence TGTTAGGGAGAACACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065654582_1065654587 4 Left 1065654582 10:27934951-27934973 CCTCCCAAGTGTTCTCCCTAACA 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1065654587 10:27934978-27935000 TATAAAATCTTTCCATCTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 267
1065654582_1065654591 27 Left 1065654582 10:27934951-27934973 CCTCCCAAGTGTTCTCCCTAACA 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1065654591 10:27935001-27935023 GCCACTTACATCATACTTTCAGG 0: 1
1: 0
2: 1
3: 4
4: 134
1065654582_1065654588 5 Left 1065654582 10:27934951-27934973 CCTCCCAAGTGTTCTCCCTAACA 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1065654588 10:27934979-27935001 ATAAAATCTTTCCATCTCCAGGG 0: 1
1: 0
2: 2
3: 27
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065654582 Original CRISPR TGTTAGGGAGAACACTTGGG AGG (reversed) Intronic
900791805 1:4685707-4685729 TGTTAGGGTGCACCGTTGGGGGG + Intronic
901166545 1:7225543-7225565 TGTTGCTGAGAACACCTGGGAGG + Intronic
901590855 1:10341265-10341287 TGTTGGGGAGGATAGTTGGGTGG + Intronic
905264447 1:36741477-36741499 TGTTACGGAAAACAGTTTGGTGG - Intergenic
908119266 1:60970468-60970490 TGTTAGGGAGAAGAGCAGGGAGG - Intronic
910991106 1:93057629-93057651 TGGTATGGAGAACAGTTTGGAGG + Intergenic
911289443 1:96039004-96039026 TGTTAGGGGGATCTTTTGGGAGG - Intergenic
911921174 1:103762826-103762848 TGCTATGGAAAACAGTTGGGAGG + Intergenic
912326720 1:108770354-108770376 TGGGAGGGAGAAGCCTTGGGCGG + Intronic
912525448 1:110279472-110279494 TCTCAGGGAGACCACATGGGAGG - Intronic
912931474 1:113967294-113967316 TATTATGGAGAACAGTTTGGAGG - Intronic
916795640 1:168164817-168164839 GAATAGGGAGAACAGTTGGGAGG + Intergenic
917186623 1:172363815-172363837 TGTTAGGGAAAATACTGGGGAGG - Intronic
919319974 1:196023717-196023739 TGTTAGTGAGAACAATTAGAAGG - Intergenic
921347659 1:214203559-214203581 TATCAGGGAGAAAACATGGGGGG - Intergenic
921410465 1:214831227-214831249 AGTTAGGGAGAAGTCTTGGCAGG - Intergenic
1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG + Intronic
1063966626 10:11351234-11351256 TTTAAGGCAGAACACTTGGTTGG - Intergenic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1066592735 10:37013062-37013084 TGAAAGGAAGAACACTTGGATGG + Intergenic
1068327757 10:55516635-55516657 ATTTATGGAGAAGACTTGGGTGG - Intronic
1071233334 10:83615141-83615163 TCCTAGGGAAAACACATGGGAGG - Intergenic
1072031926 10:91529590-91529612 TTTTAGGTAGAAGACCTGGGTGG - Intergenic
1074194019 10:111164418-111164440 TGTTAGTGGAAACACTTGTGGGG - Intergenic
1074294754 10:112174720-112174742 TTTTAGGGAATAGACTTGGGGGG - Intronic
1075746517 10:124731956-124731978 AGATAGGGAGAAGACTTGGGAGG - Intronic
1075950386 10:126472518-126472540 TGTTTGGGAGTGGACTTGGGTGG + Intronic
1077959121 11:7054377-7054399 TATTATGGAGAACAGTTTGGAGG - Intronic
1080114092 11:28602358-28602380 TGACAGGGAGAACACATGTGAGG - Intergenic
1081162098 11:39761581-39761603 TGATAGGGAGAAAACTTTAGCGG - Intergenic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1082198980 11:49340104-49340126 TGCTGGGAAGAAAACTTGGGAGG + Intergenic
1082664105 11:55951807-55951829 TTTTAGGGGGAACAATTGTGAGG - Intergenic
1083295992 11:61715969-61715991 TGTCAGGGAAGACACTGGGGTGG + Intronic
1083506343 11:63160910-63160932 TGCTATGGAGAACAGTTTGGAGG + Intronic
1085054640 11:73396365-73396387 CTTTAGGGAGAAGACTTGGTGGG + Exonic
1085674362 11:78501765-78501787 TGTTATGGAAAACAATTTGGTGG + Intronic
1086229897 11:84555885-84555907 AGTTGGGGAGACCAGTTGGGAGG + Intronic
1086494977 11:87393682-87393704 TGATATGGAGAACATTTTGGTGG + Intergenic
1091563895 12:1633835-1633857 TCTTAGGGAGGATACTTGGAAGG + Intronic
1093531411 12:20169239-20169261 CATTAGGGAGAACAGTTTGGAGG - Intergenic
1094186469 12:27648420-27648442 TGCTATGGAGAACAGTTTGGAGG + Intronic
1095622551 12:44275367-44275389 TGTTATGGAGAACAGTTTGGAGG + Intronic
1096025140 12:48353956-48353978 TACTAGGGAGAACAGTTTGGAGG - Intergenic
1096930534 12:55203718-55203740 TGCTATGGAGAACATTTTGGGGG + Intergenic
1100562335 12:95760446-95760468 TGTTGGGTAGAATACTGGGGAGG - Intronic
1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG + Intergenic
1101545231 12:105706245-105706267 TGTCCTGGAGAACTCTTGGGTGG - Intergenic
1104159387 12:126163808-126163830 AGAGAGGGAGAACACCTGGGGGG + Intergenic
1108939314 13:55932497-55932519 AGTTTGGGATAGCACTTGGGAGG - Intergenic
1108961725 13:56241760-56241782 CGCTATGAAGAACACTTGGGAGG - Intergenic
1112424022 13:99280071-99280093 TGACAGGGAGAACAGTTAGGAGG - Intronic
1112723894 13:102279891-102279913 TATTAGGGAGAAGACTTGGAAGG - Intronic
1115313742 14:32005394-32005416 GGAAAGGGAGAACACTTGAGAGG + Intergenic
1117024927 14:51609452-51609474 GGTTGGGGAGAACACTAGGAAGG + Intronic
1118493470 14:66285045-66285067 AGGTAGGGAAAACACTTAGGAGG - Intergenic
1118859467 14:69651243-69651265 TGTTAAAGAGAAGACTTAGGTGG + Intronic
1133081890 16:3328408-3328430 TTTTAGGGAGTAAACTTAGGCGG - Intergenic
1139142767 16:64288141-64288163 TGTCAGGGAGAACACAAGGCAGG - Intergenic
1148914884 17:50968065-50968087 TGTTAGGGACTCCACTTGGCTGG - Intronic
1149075232 17:52588904-52588926 TGCTATGAAGAACAGTTGGGAGG - Intergenic
1152211189 17:79004119-79004141 AGTTAGGGAGAGGAGTTGGGGGG + Intronic
1153476815 18:5506151-5506173 AGGTAGGGAGACCAGTTGGGAGG - Intronic
1153642605 18:7169699-7169721 TGTCAGGGACAGCACCTGGGGGG - Intergenic
1154359642 18:13648738-13648760 TGTTAGGAAGAACATTTGGTGGG + Exonic
1168599412 19:57706046-57706068 TGTTTGGGAGAAGAGTAGGGAGG + Intronic
926065356 2:9835004-9835026 CATTAGGGAGAACAGTTTGGAGG + Intergenic
926479156 2:13367170-13367192 TGCTATGGAGAACAATTTGGAGG + Intergenic
928263819 2:29792138-29792160 TGTTAGGGAAAACAAATGGAGGG + Intronic
930414204 2:51069363-51069385 TATTAGGGAAAGCACTTGTGCGG + Intergenic
930859621 2:56057010-56057032 TGATAGGGAGAAAGCTTGAGTGG - Intergenic
932858502 2:75264258-75264280 TACTAGGGAGAACAGTTTGGAGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935186366 2:100737036-100737058 TGATGGAGAGAACACTTGGAAGG + Intergenic
936933350 2:117813466-117813488 AGAGAGGGAGAAAACTTGGGAGG - Intergenic
939416393 2:141904209-141904231 AGACAGGGAGAACAGTTGGGAGG + Intronic
939654138 2:144801824-144801846 TGGCAGGGAGTACATTTGGGTGG + Intergenic
942001975 2:171656749-171656771 TATTATGGAGAACACTTTGGGGG + Intergenic
942150291 2:173069744-173069766 TGTTAAGGAGTAATCTTGGGAGG - Intergenic
948634381 2:239325639-239325661 TGTTGTGGAAAACACTTTGGTGG + Intronic
1168931826 20:1630332-1630354 TATGAGAGAGACCACTTGGGAGG + Intronic
1170282870 20:14670798-14670820 TGGTAGAAAGAACAGTTGGGAGG - Intronic
1173303382 20:41825016-41825038 TGCTATGGAGAACAGTTTGGAGG - Intergenic
1173400524 20:42722105-42722127 AGGAAGGGAGGACACTTGGGAGG - Intronic
1175139687 20:56851115-56851137 TGTTAGGGAAAACACCTTGTTGG - Intergenic
1177007374 21:15690329-15690351 TGTTAAAGGGTACACTTGGGAGG + Intergenic
1178257298 21:31065867-31065889 GCTTAGGGACAACACTTGGCAGG + Intergenic
1178340487 21:31782024-31782046 TGCAATGGAGAAGACTTGGGAGG - Intergenic
1179526975 21:41985496-41985518 TGTTATGGGGAACACTTAGGAGG + Intergenic
1180865614 22:19117472-19117494 TGTTAGTGAGAACGATGGGGTGG + Intronic
1185104626 22:48860335-48860357 TTCCAGGCAGAACACTTGGGAGG - Intergenic
1185114250 22:48922395-48922417 TGTTATGGAGAACACTGGGCAGG - Intergenic
950572211 3:13808463-13808485 CGTGAGGGAGAACCCTTGGCTGG - Intergenic
951691607 3:25402374-25402396 TACTAGGGAGAACAGTTTGGAGG + Intronic
952442622 3:33347590-33347612 TGTTATGAAGAACAGTTTGGAGG - Intronic
953040467 3:39251271-39251293 TGTTAGGGAGAACACCTGTGAGG - Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
957313606 3:78549637-78549659 TATTTTGGAGCACACTTGGGTGG - Intergenic
958164648 3:89864326-89864348 TTTAAGGATGAACACTTGGGAGG - Intergenic
959966734 3:112364128-112364150 TTTTATGGGGAAGACTTGGGAGG + Intergenic
962949159 3:140202250-140202272 TGTCAGGGAGACCACTTAGTAGG + Intronic
963772264 3:149399673-149399695 TGGAAGGATGAACACTTGGGTGG - Intergenic
964350537 3:155799191-155799213 CGTTATGGAGAACAGTTTGGAGG + Intronic
965974177 3:174601209-174601231 TGCTATGGAGAACAGTTTGGAGG - Intronic
967817210 3:193809573-193809595 TGTTGGTGAGAACACTGGAGGGG - Intergenic
968073421 3:195802275-195802297 CGATGGGGTGAACACTTGGGAGG - Intronic
970689491 4:18606286-18606308 TGATAGGGAGAACACTTGCAAGG - Intergenic
975939895 4:79630017-79630039 TAATAGAGAAAACACTTGGGAGG - Intergenic
977050583 4:92124370-92124392 TGTTGGGAAGAACACTTTAGGGG + Intergenic
977572744 4:98646459-98646481 TGTTAGGCCTAACACCTGGGTGG - Intronic
978221430 4:106280003-106280025 TGCTATGGAGAACAGTTTGGAGG - Intronic
983417458 4:167476864-167476886 TCATAGGGAGAAGACCTGGGAGG + Intergenic
983714814 4:170767541-170767563 TGGTAGGTAGTACTCTTGGGAGG + Intergenic
984685586 4:182664726-182664748 TGATAAGGAGAACATTTGAGTGG + Intronic
985676091 5:1232087-1232109 TGTTGGGGGCACCACTTGGGTGG - Intronic
986657126 5:10025137-10025159 TATTATGGAGAACAGTTTGGAGG - Intergenic
986763073 5:10897647-10897669 TCTTAGGAAGAATAATTGGGAGG + Intergenic
989654080 5:43725591-43725613 TGATATGGAGAAAACTTGAGTGG - Intergenic
993852401 5:93026752-93026774 TGTTATGGAGAACATTTTGGAGG + Intergenic
994844270 5:104965985-104966007 TGCTAAGGAGAAAACCTGGGGGG - Intergenic
995405243 5:111787344-111787366 TGTTAGGAATAACAATTGGAAGG - Intronic
996045778 5:118872205-118872227 TGATAGGGAGAAAATTTGAGTGG - Intronic
997594088 5:135094834-135094856 TGGCAGGGAGACCACATGGGTGG - Intronic
998060405 5:139114503-139114525 TGTTAGGGAGAACCACTTGGGGG - Intronic
998434878 5:142099301-142099323 TGTTAGTGACAACCCTTGGAAGG + Intergenic
999302572 5:150500345-150500367 TGGTAGGGAGGAGCCTTGGGTGG + Intronic
1001433468 5:171681632-171681654 TCATGGGGAGAAAACTTGGGAGG + Intergenic
1002810946 6:628055-628077 TGTAAGGATGAACACTTGTGAGG + Intronic
1003237969 6:4315774-4315796 AGTTAGGGAGCCCACTTCGGAGG - Intergenic
1003483907 6:6557969-6557991 GGTTAGGGTGAAGACGTGGGAGG - Intergenic
1005703019 6:28422909-28422931 TGTTAAGGAGAACGCTGAGGAGG - Intergenic
1007426089 6:41747113-41747135 TGTTAGACAGGACACATGGGTGG - Intronic
1008088253 6:47266952-47266974 TGATAGGGTGAAGCCTTGGGAGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1010504018 6:76633986-76634008 TGTTAAGAGGAACACATGGGCGG - Intergenic
1012480921 6:99665938-99665960 TGTGAGGGAGAAGAGGTGGGGGG + Intergenic
1018638966 6:165889681-165889703 TGTCATGGAGGACACTTGAGGGG - Intronic
1020439738 7:8204558-8204580 TGTTAGGGAAAACTCTAGGCTGG + Intronic
1020928906 7:14368792-14368814 TATTAGGGAAAACGCTTGTGAGG + Intronic
1021928670 7:25557741-25557763 TGTGATGGAAAGCACTTGGGAGG + Intergenic
1023619571 7:42055923-42055945 TGTTGGGGGGAACATGTGGGAGG + Intronic
1024061498 7:45702277-45702299 TGTTAGAGGGAACACTTGTAGGG - Intronic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026484307 7:70804785-70804807 TGTTATGGAAAACAGTTGGGAGG + Intergenic
1028260044 7:88652733-88652755 TATTATGGAGAACAGTTTGGAGG + Intergenic
1030312574 7:108083193-108083215 TGCTGAGGAGAATACTTGGGAGG + Intronic
1031580731 7:123471634-123471656 TGTTAGGCTAAAAACTTGGGGGG - Intronic
1037986629 8:23294512-23294534 GGTCAGGGAGAGCACTGGGGAGG - Intronic
1039690875 8:39863309-39863331 TGTGAGGGGGAGCAGTTGGGGGG - Intergenic
1040774089 8:51018071-51018093 TGATATGGAGAACATTTTGGTGG - Intergenic
1040994116 8:53384414-53384436 TGACATGGAGAACACTTGTGGGG - Intergenic
1043082008 8:75778286-75778308 TATTTGGCAGAACACTTGAGTGG + Intergenic
1046902229 8:119535818-119535840 TGTAACTGAGAAAACTTGGGAGG + Intergenic
1049826423 8:144671711-144671733 TCGTAGGGAGAACCCTAGGGTGG - Intergenic
1052080348 9:24198412-24198434 TGCTATGGAGAACAGTTTGGAGG - Intergenic
1052305988 9:27010361-27010383 TGTTTGATAGAACACTAGGGTGG - Intronic
1052750160 9:32482114-32482136 AGGTAGGGAGAACAGTTTGGAGG - Intronic
1053465603 9:38305754-38305776 TGATAAGGAGAACACTTGAGTGG - Intergenic
1053736019 9:41103473-41103495 TGTTAGGGAGGTCAATTGTGGGG - Intergenic
1054692354 9:68327926-68327948 TGTTAGGGAGGTCAATTGTGGGG + Intergenic
1055377266 9:75662717-75662739 TGATAGGGAGAACATTTTAGTGG + Intergenic
1055563914 9:77549280-77549302 GATGAGGGAGAGCACTTGGGAGG - Intronic
1060278735 9:122201529-122201551 CGCTAGGGAGCAGACTTGGGAGG + Intergenic
1186410272 X:9340521-9340543 GGATGGGGAGAACACTTAGGAGG - Intergenic
1186781126 X:12912987-12913009 TGTTTAGGTGGACACTTGGGCGG - Intronic
1186897445 X:14018196-14018218 TGTTAGGTAGAACTCTAGGTAGG - Intronic
1188388044 X:29585592-29585614 TGTTATGGAGAACAGTTTGAAGG - Intronic
1190369084 X:49724427-49724449 TGTGAGGGAGGCCATTTGGGAGG - Intergenic
1191054085 X:56224161-56224183 GGTTAGGGAGACCAATTAGGAGG + Intergenic
1192957052 X:76082899-76082921 TGCTATGGAGAACAGTTTGGAGG - Intergenic
1193725111 X:85029103-85029125 TACTATGGAGAACACTTTGGAGG - Intronic
1194965787 X:100287333-100287355 TGGCAGGGAGACCACTTAGGAGG - Intergenic
1197745678 X:129931462-129931484 GGGAAGGGAGAACACTTCGGAGG - Intergenic
1198964184 X:142210241-142210263 TGCTATGGAGAACAGTTTGGAGG - Intergenic
1199362285 X:146935929-146935951 CATTATGGAGAACACTTTGGAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic