ID: 1065655844

View in Genome Browser
Species Human (GRCh38)
Location 10:27949195-27949217
Sequence ATGCTTCCTATTTGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065655843_1065655844 20 Left 1065655843 10:27949152-27949174 CCTCAAATCACTTTTGTGTTATT 0: 1
1: 1
2: 2
3: 52
4: 502
Right 1065655844 10:27949195-27949217 ATGCTTCCTATTTGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065655844 Original CRISPR ATGCTTCCTATTTGCCATGC TGG Intronic
No off target data available for this crispr