ID: 1065656060

View in Genome Browser
Species Human (GRCh38)
Location 10:27951476-27951498
Sequence GTGGTATCCCAGATTATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065656056_1065656060 21 Left 1065656056 10:27951432-27951454 CCAGAAACAAACTCTCACGTGTG 0: 1
1: 0
2: 0
3: 18
4: 215
Right 1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065656060 Original CRISPR GTGGTATCCCAGATTATTGG AGG Intronic
No off target data available for this crispr