ID: 1065656411

View in Genome Browser
Species Human (GRCh38)
Location 10:27956121-27956143
Sequence TACCCCTCACCAACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065656408_1065656411 26 Left 1065656408 10:27956072-27956094 CCACGCCAGTGTTTGATGAATTT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1065656411 10:27956121-27956143 TACCCCTCACCAACCCATCATGG No data
1065656409_1065656411 21 Left 1065656409 10:27956077-27956099 CCAGTGTTTGATGAATTTGATGA 0: 2
1: 0
2: 1
3: 22
4: 241
Right 1065656411 10:27956121-27956143 TACCCCTCACCAACCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065656411 Original CRISPR TACCCCTCACCAACCCATCA TGG Intronic
No off target data available for this crispr