ID: 1065661039

View in Genome Browser
Species Human (GRCh38)
Location 10:28004421-28004443
Sequence CTGGATCATCAGGAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065661039_1065661045 -5 Left 1065661039 10:28004421-28004443 CCTCCCTCTTCCTGATGATCCAG No data
Right 1065661045 10:28004439-28004461 TCCAGGGCAGTTTCTTCTATTGG No data
1065661039_1065661047 -4 Left 1065661039 10:28004421-28004443 CCTCCCTCTTCCTGATGATCCAG No data
Right 1065661047 10:28004440-28004462 CCAGGGCAGTTTCTTCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065661039 Original CRISPR CTGGATCATCAGGAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr