ID: 1065661039 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:28004421-28004443 |
| Sequence | CTGGATCATCAGGAAGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065661039_1065661045 | -5 | Left | 1065661039 | 10:28004421-28004443 | CCTCCCTCTTCCTGATGATCCAG | No data | ||
| Right | 1065661045 | 10:28004439-28004461 | TCCAGGGCAGTTTCTTCTATTGG | No data | ||||
| 1065661039_1065661047 | -4 | Left | 1065661039 | 10:28004421-28004443 | CCTCCCTCTTCCTGATGATCCAG | No data | ||
| Right | 1065661047 | 10:28004440-28004462 | CCAGGGCAGTTTCTTCTATTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065661039 | Original CRISPR | CTGGATCATCAGGAAGAGGG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||