ID: 1065663387

View in Genome Browser
Species Human (GRCh38)
Location 10:28030536-28030558
Sequence TAATCAAATTAGAGTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065663387_1065663389 -9 Left 1065663387 10:28030536-28030558 CCCAGATTACTCTAATTTGATTA No data
Right 1065663389 10:28030550-28030572 ATTTGATTATTACACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065663387 Original CRISPR TAATCAAATTAGAGTAATCT GGG (reversed) Intergenic
No off target data available for this crispr