ID: 1065667438

View in Genome Browser
Species Human (GRCh38)
Location 10:28077243-28077265
Sequence CAAGCTCACGACACCCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065667435_1065667438 17 Left 1065667435 10:28077203-28077225 CCTAGGTAATATGCTAACTTTAT 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1065667438 10:28077243-28077265 CAAGCTCACGACACCCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065667438 Original CRISPR CAAGCTCACGACACCCATGT AGG Intronic
No off target data available for this crispr