ID: 1065677366

View in Genome Browser
Species Human (GRCh38)
Location 10:28192040-28192062
Sequence CTTGAACCCCAGAGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065677364_1065677366 10 Left 1065677364 10:28192007-28192029 CCAGCTACTTGAGAAGCTGAGGC 0: 175
1: 7345
2: 99912
3: 211918
4: 245682
Right 1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG No data
1065677362_1065677366 11 Left 1065677362 10:28192006-28192028 CCCAGCTACTTGAGAAGCTGAGG 0: 250
1: 9346
2: 114394
3: 225343
4: 257829
Right 1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG No data
1065677361_1065677366 19 Left 1065677361 10:28191998-28192020 CCTGTAATCCCAGCTACTTGAGA 0: 2118
1: 55963
2: 154319
3: 262691
4: 534535
Right 1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065677366 Original CRISPR CTTGAACCCCAGAGGCAGCC TGG Intronic
No off target data available for this crispr