ID: 1065679839

View in Genome Browser
Species Human (GRCh38)
Location 10:28217866-28217888
Sequence TGCTTTTGATGTAGTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065679839_1065679843 27 Left 1065679839 10:28217866-28217888 CCAGCTGGACTACATCAAAAGCA No data
Right 1065679843 10:28217916-28217938 CCAACTTACCCAAATGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065679839 Original CRISPR TGCTTTTGATGTAGTCCAGC TGG (reversed) Intronic