ID: 1065683930

View in Genome Browser
Species Human (GRCh38)
Location 10:28265000-28265022
Sequence TAGGGTAGACAGACAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065683924_1065683930 7 Left 1065683924 10:28264970-28264992 CCTCTCTACCAGTTTCATTAGTG No data
Right 1065683930 10:28265000-28265022 TAGGGTAGACAGACAGGACAAGG No data
1065683926_1065683930 -1 Left 1065683926 10:28264978-28265000 CCAGTTTCATTAGTGGAGATTAT 0: 1
1: 0
2: 1
3: 17
4: 153
Right 1065683930 10:28265000-28265022 TAGGGTAGACAGACAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065683930 Original CRISPR TAGGGTAGACAGACAGGACA AGG Intronic
No off target data available for this crispr