ID: 1065685456

View in Genome Browser
Species Human (GRCh38)
Location 10:28280099-28280121
Sequence TGCTGAACTGAATTCCTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065685456_1065685460 17 Left 1065685456 10:28280099-28280121 CCAGCCAGGAATTCAGTTCAGCA 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1065685460 10:28280139-28280161 ACCTAACAGGACAAAAATAAAGG 0: 1
1: 0
2: 1
3: 39
4: 349
1065685456_1065685462 18 Left 1065685456 10:28280099-28280121 CCAGCCAGGAATTCAGTTCAGCA 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1065685462 10:28280140-28280162 CCTAACAGGACAAAAATAAAGGG 0: 1
1: 0
2: 1
3: 36
4: 446
1065685456_1065685459 4 Left 1065685456 10:28280099-28280121 CCAGCCAGGAATTCAGTTCAGCA 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1065685459 10:28280126-28280148 CCAAGACTGCTATACCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065685456 Original CRISPR TGCTGAACTGAATTCCTGGC TGG (reversed) Exonic
900232737 1:1569532-1569554 TGCGCCACTGAACTCCTGGCTGG - Intronic
903283837 1:22265012-22265034 TGCTGAGCTGAATTCTTGCTGGG - Intergenic
903761882 1:25704102-25704124 TGCGGGACTGCTTTCCTGGCTGG - Intronic
910064278 1:83134689-83134711 AGCTGTTCTGAGTTCCTGGCTGG - Intergenic
912427885 1:109610636-109610658 TGCTGCCCTCAATTTCTGGCAGG + Exonic
916897445 1:169179864-169179886 TGCTGGATTTAATTCCTGGGTGG + Intronic
918859127 1:189798935-189798957 TGCTGTACAGAATGCATGGCTGG + Intergenic
919669300 1:200324331-200324353 GGCTGAACTCAGTTCCTTGCAGG - Intergenic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920576316 1:207063400-207063422 TGCTGAACAGAATTCCTTCAAGG + Exonic
921064207 1:211611367-211611389 GGCTGAAATGATTTGCTGGCTGG - Intergenic
921796502 1:219350899-219350921 TGCTGAAACCAATTCCTGGCAGG + Intergenic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066289752 10:34002930-34002952 TCATGAACTGAACTCATGGCAGG - Intergenic
1067141645 10:43662854-43662876 TGCTTCACTGTATTCCAGGCTGG - Intergenic
1071171537 10:82870504-82870526 TGCCGAACTGAATTCCAAGGTGG + Intronic
1072572989 10:96674934-96674956 TGCAGAACTGCATTCCAGCCTGG - Intronic
1077077428 11:707887-707909 TGCTTAATGGGATTCCTGGCGGG - Intronic
1077778202 11:5294606-5294628 TGCTGTGCTCAATTCCTCGCCGG - Intronic
1080647533 11:34197747-34197769 TGCTGAATTAAATACTTGGCAGG + Intronic
1081032865 11:38108861-38108883 TGCTGAACTGAATTAATTGTAGG - Intergenic
1083313240 11:61796838-61796860 TACAGAAATGATTTCCTGGCTGG + Exonic
1086282844 11:85210691-85210713 TGCTGTGCTGAAATACTGGCTGG - Intronic
1087943199 11:104126277-104126299 TGCTCCACTGAAATCCAGGCAGG - Intronic
1088250470 11:107857423-107857445 TTCTGGACTCAAATCCTGGCTGG - Intronic
1089040286 11:115442007-115442029 TGCTGAACTGAATTCTGTGAAGG - Intronic
1089292059 11:117443457-117443479 TGCTGAACTGGACACCGGGCAGG - Intronic
1090831011 11:130420891-130420913 TGCCGAGATGAACTCCTGGCCGG + Intronic
1091622684 12:2101354-2101376 TGCTGAACTGCTGTCCTGACAGG + Intronic
1092969821 12:13682755-13682777 GGCTGAACTGAATTCATGAGAGG + Intronic
1093256172 12:16871061-16871083 TGCTGAACTAAATGCCTGTCTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1096139582 12:49231989-49232011 TGCTGGGCTGATTTCCTGGCTGG + Intronic
1096327122 12:50673740-50673762 TGCACCACTGCATTCCTGGCTGG + Intronic
1096791693 12:54048905-54048927 TGGTGACCTGAATTTCTTGCTGG - Intronic
1098976002 12:76902761-76902783 TGCTGAATTGTATTCCTAGGAGG + Intergenic
1100013402 12:89980319-89980341 TGCTGCCCTCAGTTCCTGGCTGG - Intergenic
1101431377 12:104630385-104630407 TGCTTAAGACAATTCCTGGCAGG + Intronic
1103060934 12:117858023-117858045 TGCTGAACTGAGCTCCTGTCTGG - Intronic
1103307006 12:119973187-119973209 TGCAAAACTGAAATTCTGGCCGG - Intergenic
1107580119 13:41774437-41774459 ATCTGAAATAAATTCCTGGCTGG - Intronic
1109929721 13:69198884-69198906 TGCTGGACTGCATTCCTATCTGG - Intergenic
1110609813 13:77475664-77475686 TGCTGTGCTGAATTTCTCGCCGG - Intergenic
1112887328 13:104190651-104190673 TGCTGTAGTGAATCCCTGCCAGG + Intergenic
1117128594 14:52660128-52660150 TATTGAACTGATTTCTTGGCTGG - Intronic
1117488700 14:56225184-56225206 TGCTGCTCGGAATTCCTGGACGG - Intronic
1118791020 14:69093208-69093230 TGGAGCACTGAATTACTGGCAGG + Intronic
1119780796 14:77275683-77275705 TGCTTAATTGCATTTCTGGCAGG - Exonic
1120303773 14:82741151-82741173 TTCTGAAGTTAATTCATGGCAGG - Intergenic
1121062369 14:90925128-90925150 TTCTGTACTCACTTCCTGGCTGG - Intronic
1121840033 14:97126231-97126253 TGCTTAACAGAGTGCCTGGCTGG + Intergenic
1122760978 14:104026173-104026195 TGCTGGACAGGATTCCTGGGTGG + Intronic
1125220619 15:37329367-37329389 TGCAGAACTGATTTCCTCGAGGG + Intergenic
1125763563 15:42116942-42116964 TGAAAAACTGAATTACTGGCTGG + Intergenic
1125807971 15:42510679-42510701 TACTGGACTGAATTCTTGGAAGG - Intronic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1128984293 15:72207954-72207976 TGCTGAGTTGTATTCCTAGCAGG + Intronic
1132561490 16:596615-596637 GGCTGAGCTGACTTCCTGGGCGG + Intronic
1134230543 16:12425749-12425771 TTCAGAAATGAATTCCTGGCTGG - Intronic
1135843576 16:25897740-25897762 TGCTGGATTGTGTTCCTGGCAGG + Intronic
1136595211 16:31244188-31244210 GGCTGAACTGAATTGTTGTCAGG - Intergenic
1137568023 16:49545820-49545842 TGTTTAGCTGAATGCCTGGCAGG - Intronic
1142901801 17:3016924-3016946 TGCTGAGTTGCATTCCTGCCCGG + Intronic
1144506520 17:15835996-15836018 TGCTGATTTGCATTCCTGCCTGG - Intergenic
1145170695 17:20653929-20653951 TGCTGATTTGCATTCCTGCCTGG - Intergenic
1146287189 17:31581913-31581935 TGCTGAAGTGTACTCCTGGCCGG - Intergenic
1148375045 17:47135844-47135866 TTAAGAACTGAGTTCCTGGCCGG + Intronic
1149237110 17:54605339-54605361 TGATGAACTGAATTCCAGAGAGG - Intergenic
1150974562 17:70070109-70070131 TGCTGAACTGAATTGCTCCTTGG + Intronic
1151096400 17:71503905-71503927 AGATGAACAGAATACCTGGCAGG - Intergenic
1151838738 17:76602074-76602096 TGCTGTACTGCATTCCTAGGGGG - Intergenic
1152213537 17:79018337-79018359 TGCTGGGCTGTATTCCTGGGAGG + Intergenic
1152355547 17:79805164-79805186 TGCGGAACTGAGTCCCTGGAAGG - Intergenic
1152533900 17:80939551-80939573 TGCTGAGCTGCAAGCCTGGCTGG - Intronic
1152554876 17:81048086-81048108 GGATAAACAGAATTCCTGGCCGG + Intronic
1203162944 17_GL000205v2_random:68491-68513 TGCTAATCTGACTTCCAGGCTGG + Intergenic
1153044727 18:845242-845264 TGACGAAATGAATTCCTGCCTGG - Intergenic
1153552763 18:6279468-6279490 TGCTGAACAGAATTCCTGAATGG + Intronic
1155557659 18:27038554-27038576 TGCAGAACTGAAGCCCTTGCTGG - Intronic
1156844798 18:41652803-41652825 TGCTGGGCTCAATTCTTGGCTGG + Intergenic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1157404833 18:47414131-47414153 AGCTGAGATGAATTCCTGGATGG + Intergenic
1157649445 18:49313074-49313096 TGCTGGACTGCATTCCTAGGAGG + Intronic
1159662237 18:71112350-71112372 TGCTGAACTGAATGCCAGTTTGG + Intergenic
1159670210 18:71212689-71212711 TGCTGTACTGGATTTCTTGCAGG - Intergenic
1159955368 18:74515187-74515209 TGATGAACTCAAATCCTGGCCGG - Intronic
1163459594 19:17428910-17428932 TGCATAACTGCACTCCTGGCTGG + Intronic
1166885129 19:45955966-45955988 TGCTGCACTGAAGTGCTTGCTGG - Intronic
1167009410 19:46796881-46796903 TGCGCCACTGAACTCCTGGCTGG - Intergenic
929440601 2:41963430-41963452 TGCTGAACTTGTCTCCTGGCAGG + Intergenic
929515091 2:42599640-42599662 TGATGAAATTAATTCCTGTCAGG - Intronic
930056183 2:47253907-47253929 TGCCAAACTGAGTTCCTGGCAGG - Intergenic
930120811 2:47759153-47759175 TGGTGAACTGGACTCCTGCCTGG + Intronic
933074630 2:77907517-77907539 TGCTACACTCAATTCCTTGCAGG - Intergenic
934112243 2:88754837-88754859 CTCGGAACTGAAGTCCTGGCCGG + Intergenic
935825868 2:106948660-106948682 TGCAAAAGTGCATTCCTGGCTGG - Intergenic
936774568 2:115957230-115957252 TACTGAAATACATTCCTGGCCGG - Intergenic
939788990 2:146548486-146548508 AGCTAGACTGAAGTCCTGGCTGG - Intergenic
942198730 2:173549555-173549577 TGATTAACAGAAGTCCTGGCAGG - Intergenic
942966252 2:181895825-181895847 TGCTGAACTGACCTGATGGCAGG + Intronic
944132498 2:196361948-196361970 AGCTGAACTGAAGTCAAGGCGGG + Intronic
945067770 2:205961557-205961579 TGCTTATCTGAAGGCCTGGCAGG - Intergenic
946119321 2:217495649-217495671 TGCTGAACTGGATACGTGGTAGG + Intronic
946590315 2:221239954-221239976 TTCTGAACTGAGGTCCTGCCTGG + Intergenic
947998668 2:234549214-234549236 TGCTGTACTGGCTTCTTGGCCGG + Intergenic
1168972695 20:1941634-1941656 TGCTTGACTGATTTCCTGGAGGG - Intergenic
1170340039 20:15314763-15314785 TGAAGAACTGAAATCCTGGGAGG + Intronic
1172106411 20:32519705-32519727 TGCTGAAGTGAGGTCCTTGCTGG + Intronic
1172212373 20:33209902-33209924 TGCTGAAATCTATTCCTGTCGGG - Intergenic
1172585767 20:36083332-36083354 TGCTGGGCTGCATTCCTAGCTGG + Intergenic
1173007742 20:39153339-39153361 TGATGACCTGAATTCCAGGAAGG - Intergenic
1176151270 20:63592319-63592341 CTCTGAACTGAGCTCCTGGCTGG - Intronic
1176516240 21:7785802-7785824 TGCTGGACTGCATTCCAGGAGGG + Intergenic
1178650268 21:34415814-34415836 TGCTGGACTGCATTCCAGGAGGG + Intergenic
1178813380 21:35905093-35905115 TGCTGAAATGATTTCAAGGCTGG - Intronic
1180960357 22:19759634-19759656 TGCTGAAGTGCATCCCTGCCGGG - Exonic
1181873215 22:25919636-25919658 TGCTGAACTGAGTTAAGGGCTGG - Intronic
1182242130 22:28924433-28924455 TTTTGATCTGAATTCCTAGCTGG - Intronic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
949838334 3:8293099-8293121 TGATGAACTGGATTGCTTGCTGG - Intergenic
951150543 3:19284825-19284847 TGCTGATCAGAAATCTTGGCTGG + Intronic
951725919 3:25758978-25759000 TTCTGAACATAATTCCAGGCTGG - Intronic
952870137 3:37891555-37891577 TGTTGTACTGAATTCCTAGTAGG + Intronic
954264306 3:49461067-49461089 AGCTGGACAGAATTTCTGGCTGG - Intergenic
954863556 3:53710238-53710260 TGCTGAGCTGGATTCCTAGCAGG + Intronic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
956330151 3:68097810-68097832 TGCTGGACTGATTTCCTGCAGGG + Intronic
958133212 3:89456255-89456277 TTCAAAACTGAATTCGTGGCTGG + Intronic
958942800 3:100334133-100334155 TGCTGCACTGCACTCCTGACTGG + Intergenic
960723382 3:120646348-120646370 TGCTGAACCGCATTCCTCTCTGG + Exonic
961101015 3:124199113-124199135 TGCTGAACTGAGTTCCTGAGTGG + Intronic
961280462 3:125762638-125762660 TGCTGAACTGAAATCCACCCTGG + Intergenic
962173613 3:133128992-133129014 ATCTGACCTGAATTACTGGCCGG - Intronic
963744165 3:149109544-149109566 TGCTGCACTCAATTTCTCGCCGG + Intergenic
964265363 3:154889401-154889423 TGCTGCACTCAAGTTCTGGCAGG - Intergenic
964337746 3:155675182-155675204 TGCTGATCTGAAAGCCTGTCTGG - Intronic
967076188 3:186004671-186004693 TGCTAAACTTAGTTCCTGGGTGG - Intergenic
967494570 3:190128548-190128570 CGCTGAAAGGAATTCCTGTCTGG - Intergenic
967649316 3:191966095-191966117 TGCTGGACACAATTCCTGCCTGG + Intergenic
974128941 4:57729934-57729956 TGCTGCACTCAATTTCTCGCCGG - Intergenic
975676608 4:76833432-76833454 TGCTAGACTGAGTTCCTGGATGG + Intergenic
978819173 4:112945682-112945704 TGTTGAACTGAATTCTTGGCAGG - Intronic
980196666 4:129597683-129597705 TGATTATATGAATTCCTGGCAGG - Intergenic
981633371 4:146847365-146847387 TGTTGAACTCACCTCCTGGCTGG - Intronic
983227110 4:165095550-165095572 TTCTGGAAGGAATTCCTGGCAGG - Intronic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
990184081 5:53194121-53194143 TGGTGGATTGAGTTCCTGGCAGG - Intergenic
991110925 5:62898279-62898301 TGCTATACTGAATTCCTAGTAGG - Intergenic
991950099 5:71939046-71939068 TGCTGGACTTACTTCCTGCCTGG + Intergenic
992676213 5:79108979-79109001 TGCAGAACTCACTTCCTGCCAGG + Intronic
995624597 5:114062305-114062327 TGCTGCACTGCATGTCTGGCAGG - Intergenic
996716921 5:126595442-126595464 TGCTGAAAAGAATTCCCAGCTGG - Intergenic
997697156 5:135870674-135870696 TGCTGACATGAATTGGTGGCAGG - Intronic
998554034 5:143105657-143105679 TGCAGCACTGTGTTCCTGGCGGG + Intronic
999381728 5:151126144-151126166 TGCTGAAATGGAGACCTGGCTGG - Intronic
999935119 5:156478275-156478297 GGCTGAGCTCAACTCCTGGCTGG - Intronic
1004352679 6:14903937-14903959 AGCTGAGCTGAATTCAAGGCAGG + Intergenic
1005224855 6:23630742-23630764 TTGTGTACTGAGTTCCTGGCAGG + Intergenic
1007090415 6:39180903-39180925 TGCTGCACTCCGTTCCTGGCAGG - Intergenic
1007324508 6:41049763-41049785 TGGGGGCCTGAATTCCTGGCTGG - Intronic
1011022351 6:82828582-82828604 TGCTCCACTGAATTCCAGCCTGG - Intergenic
1011714170 6:90086853-90086875 TTCTGCACTGCATTCCTGGAAGG - Intronic
1013026008 6:106272337-106272359 TATTGAACTTAATCCCTGGCAGG - Intronic
1013473687 6:110488115-110488137 TGCTGAGCTGCATTCCCAGCTGG + Intergenic
1016936555 6:149452427-149452449 TGTAGAACTGACATCCTGGCCGG - Intronic
1017261780 6:152395909-152395931 AGCTGAACTGATTTCATAGCTGG + Intronic
1018483986 6:164221387-164221409 TTCTAAACTGAATTCCTTGAGGG - Intergenic
1021178246 7:17475219-17475241 TCCTGAAGTGAATTCCTAGTTGG + Intergenic
1021498115 7:21298585-21298607 TCCTAAACTGAAATGCTGGCAGG - Intergenic
1023453575 7:40314167-40314189 GGAAGAACTGGATTCCTGGCTGG - Intronic
1024430902 7:49286660-49286682 GGCTGACCTGAATGCTTGGCAGG - Intergenic
1024763770 7:52631389-52631411 TGCATCACTGAATTCCAGGCTGG + Intergenic
1026491859 7:70870418-70870440 TGCTGAGCTGAATTCCTAGTTGG - Intergenic
1027233183 7:76283414-76283436 TGCAGAGCTGAATTCCATGCCGG - Intronic
1027279830 7:76600053-76600075 AGCTGTTCTGAGTTCCTGGCTGG + Intergenic
1028433225 7:90772184-90772206 CACTGAACTGAATTCCAGCCAGG + Intronic
1030103338 7:105965661-105965683 TGCTGGACTGAACTCTTTGCAGG - Intronic
1030613659 7:111715642-111715664 TGCTGAAAAGAACTCCTGGGTGG - Intergenic
1031716910 7:125120101-125120123 TCCTGAACTGAGTTTCTGGGTGG + Intergenic
1031786069 7:126034508-126034530 AGCTGAACTCAATTGCAGGCTGG - Intergenic
1033472120 7:141659620-141659642 TGCTGACCTGAGATGCTGGCTGG - Exonic
1036719133 8:11156423-11156445 AGCTGGGCTGAATTCCTGGAGGG + Intronic
1036830911 8:12018985-12019007 TGCTGAACTGAAATCCACCCTGG - Intergenic
1037379268 8:18266910-18266932 GGCAGAACTGAATTCCTCACAGG - Intergenic
1039066720 8:33615172-33615194 TCCTGAAGTGATTTCTTGGCCGG - Intergenic
1039752319 8:40489903-40489925 TGGTGAAGTGAACTTCTGGCAGG - Intergenic
1040810769 8:51450363-51450385 TGCTGGGCTGGATTCCTAGCAGG - Intronic
1040888940 8:52295066-52295088 TGATGAAATGAATTGCTGCCTGG - Intronic
1044705442 8:95004110-95004132 TGCAGACCTGGCTTCCTGGCTGG + Intronic
1048817430 8:138346864-138346886 TGTTCAACTGAAGGCCTGGCAGG + Intronic
1049932988 9:473991-474013 TGTTGAAATTAATTCTTGGCTGG - Intronic
1051303752 9:15684687-15684709 TGCTGAACTGAATGCATTTCTGG - Intronic
1051845662 9:21448796-21448818 TGCTAAATTGAATGCCTGCCTGG - Intergenic
1053391841 9:37741428-37741450 AGCAGAACTGAGATCCTGGCAGG + Intronic
1053533325 9:38903155-38903177 TGGTGCACTGAATACATGGCTGG + Intergenic
1054205551 9:62127584-62127606 TGGTGCACTGAATACATGGCTGG + Intergenic
1054632810 9:67460786-67460808 TGGTGCACTGAATACATGGCTGG - Intergenic
1056997491 9:91477152-91477174 GGCTGGGCTGAATTCCTGTCTGG + Intergenic
1059413689 9:114150044-114150066 AAATGAACTGAATTCCAGGCTGG - Intergenic
1061996569 9:134189084-134189106 TGATTAATTGAATTCCGGGCAGG - Intergenic
1186768378 X:12793243-12793265 TGCTGCACTGAGTACCTGGAAGG - Intronic
1187594567 X:20756700-20756722 TGCTGAACTGAACTCAGAGCTGG - Intergenic
1188563692 X:31499787-31499809 TTTAGAACTGAATTCCCGGCTGG - Intronic
1191807249 X:65148242-65148264 TGCTGATCTGAAATCTTGGACGG + Intergenic
1193107979 X:77700407-77700429 TGCTGAACTGTTTTCCTGAGTGG - Intronic
1198476779 X:137002029-137002051 AGCTGAACTGAATGCCTTCCAGG + Intergenic
1201961320 Y:19683295-19683317 TTTGGAACTGAATTCCTGGTAGG - Intergenic