ID: 1065693024

View in Genome Browser
Species Human (GRCh38)
Location 10:28354581-28354603
Sequence ATACCAAGAAGGAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065693024_1065693030 13 Left 1065693024 10:28354581-28354603 CCTGCTGAGCTCCTTCTTGGTAT No data
Right 1065693030 10:28354617-28354639 TAAATATTAACTCTTTGGAGAGG No data
1065693024_1065693029 8 Left 1065693024 10:28354581-28354603 CCTGCTGAGCTCCTTCTTGGTAT No data
Right 1065693029 10:28354612-28354634 GGGCTTAAATATTAACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065693024 Original CRISPR ATACCAAGAAGGAGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr