ID: 1065695416

View in Genome Browser
Species Human (GRCh38)
Location 10:28375309-28375331
Sequence ATATTATTGCACATCTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065695416_1065695419 24 Left 1065695416 10:28375309-28375331 CCCATCTAGATGTGCAATAATAT No data
Right 1065695419 10:28375356-28375378 TTTGGATTCTAGAAGATAAAAGG No data
1065695416_1065695418 6 Left 1065695416 10:28375309-28375331 CCCATCTAGATGTGCAATAATAT No data
Right 1065695418 10:28375338-28375360 GAATTTTCGAAGAATTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065695416 Original CRISPR ATATTATTGCACATCTAGAT GGG (reversed) Intergenic
No off target data available for this crispr