ID: 1065699710

View in Genome Browser
Species Human (GRCh38)
Location 10:28412911-28412933
Sequence TAGGGGATTACAGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065699710_1065699716 -8 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699716 10:28412926-28412948 ATCCCCTACTTGGGAGGCTGAGG No data
1065699710_1065699721 14 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699721 10:28412948-28412970 GCAGGAGAATTGCTCAAACTCGG No data
1065699710_1065699722 15 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699722 10:28412949-28412971 CAGGAGAATTGCTCAAACTCGGG 0: 8
1: 236
2: 4055
3: 43767
4: 119378
1065699710_1065699723 18 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699723 10:28412952-28412974 GAGAATTGCTCAAACTCGGGAGG No data
1065699710_1065699720 -4 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699720 10:28412930-28412952 CCTACTTGGGAGGCTGAGGCAGG 0: 875
1: 79468
2: 181760
3: 220949
4: 229324
1065699710_1065699724 24 Left 1065699710 10:28412911-28412933 CCTGTAATCCCTGTAATCCCCTA No data
Right 1065699724 10:28412958-28412980 TGCTCAAACTCGGGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065699710 Original CRISPR TAGGGGATTACAGGGATTAC AGG (reversed) Intergenic
No off target data available for this crispr