ID: 1065704533

View in Genome Browser
Species Human (GRCh38)
Location 10:28460035-28460057
Sequence GTTCTCAGTGGCTCCCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065704528_1065704533 29 Left 1065704528 10:28459983-28460005 CCAGGGGAGGGGCTATGGTGAGT No data
Right 1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG No data
1065704530_1065704533 -8 Left 1065704530 10:28460020-28460042 CCAAACCTTAGCTTTGTTCTCAG No data
Right 1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG No data
1065704529_1065704533 -7 Left 1065704529 10:28460019-28460041 CCCAAACCTTAGCTTTGTTCTCA No data
Right 1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065704533 Original CRISPR GTTCTCAGTGGCTCCCAACC TGG Intergenic
No off target data available for this crispr