ID: 1065708044

View in Genome Browser
Species Human (GRCh38)
Location 10:28489278-28489300
Sequence TTCCTGAAGGGGAACCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065708044_1065708051 3 Left 1065708044 10:28489278-28489300 CCACCCAGGTTCCCCTTCAGGAA No data
Right 1065708051 10:28489304-28489326 AGGCCTCAGTCCCAGAGCTGTGG No data
1065708044_1065708057 17 Left 1065708044 10:28489278-28489300 CCACCCAGGTTCCCCTTCAGGAA No data
Right 1065708057 10:28489318-28489340 GAGCTGTGGGAGGTTCTGCCAGG No data
1065708044_1065708054 7 Left 1065708044 10:28489278-28489300 CCACCCAGGTTCCCCTTCAGGAA No data
Right 1065708054 10:28489308-28489330 CTCAGTCCCAGAGCTGTGGGAGG No data
1065708044_1065708052 4 Left 1065708044 10:28489278-28489300 CCACCCAGGTTCCCCTTCAGGAA No data
Right 1065708052 10:28489305-28489327 GGCCTCAGTCCCAGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065708044 Original CRISPR TTCCTGAAGGGGAACCTGGG TGG (reversed) Intergenic
No off target data available for this crispr