ID: 1065709532

View in Genome Browser
Species Human (GRCh38)
Location 10:28502131-28502153
Sequence ATGGGTAAACCCTCAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065709532_1065709536 24 Left 1065709532 10:28502131-28502153 CCCATATCTGAGGGTTTACCCAT No data
Right 1065709536 10:28502178-28502200 CAGTAAATGCAAAATTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065709532 Original CRISPR ATGGGTAAACCCTCAGATAT GGG (reversed) Intergenic
No off target data available for this crispr