ID: 1065709680

View in Genome Browser
Species Human (GRCh38)
Location 10:28503472-28503494
Sequence TTTGATTAATTAGGAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065709678_1065709680 -6 Left 1065709678 10:28503455-28503477 CCAAAGTGATAACAAGGTTTGAT No data
Right 1065709680 10:28503472-28503494 TTTGATTAATTAGGAAATACTGG No data
1065709677_1065709680 -5 Left 1065709677 10:28503454-28503476 CCCAAAGTGATAACAAGGTTTGA No data
Right 1065709680 10:28503472-28503494 TTTGATTAATTAGGAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065709680 Original CRISPR TTTGATTAATTAGGAAATAC TGG Intergenic
No off target data available for this crispr