ID: 1065712548

View in Genome Browser
Species Human (GRCh38)
Location 10:28532467-28532489
Sequence CAGCAGCCCCTGCCCCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065712545_1065712548 -10 Left 1065712545 10:28532454-28532476 CCCGGCGAGCTCGCAGCAGCCCC No data
Right 1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG No data
1065712541_1065712548 27 Left 1065712541 10:28532417-28532439 CCTCGGGGCGCAGGGTGAGACTT No data
Right 1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065712548 Original CRISPR CAGCAGCCCCTGCCCCGCGG AGG Intergenic
No off target data available for this crispr