ID: 1065715724

View in Genome Browser
Species Human (GRCh38)
Location 10:28565532-28565554
Sequence ACTAGAACATTAAGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065715724 Original CRISPR ACTAGAACATTAAGCAGAGC TGG (reversed) Intronic
901271431 1:7954671-7954693 ACTACAAAATGAAGCAGAGAAGG - Intronic
902483077 1:16722275-16722297 ACCAATACATTAAGCAGAGCAGG + Intergenic
903288461 1:22291871-22291893 TCTAGAACTTAAAGCAGACCAGG - Intergenic
905629572 1:39511152-39511174 ACTAGAAGACAAAGCAGCGCTGG - Exonic
905668187 1:39775038-39775060 ACTAGAAGACAAAGCAGCGCTGG + Exonic
909204230 1:72732863-72732885 ACTAGAAAATCAACCCGAGCAGG - Intergenic
909525664 1:76619867-76619889 AGTGGAACATTAGGCAGAGGAGG - Intronic
912343343 1:108939664-108939686 ACTGGAAGATGAAGCAGCGCTGG + Exonic
914424719 1:147565034-147565056 ACTAGAACGTTCTGCAGAGATGG - Intronic
915225310 1:154407067-154407089 ACTAGATCAGCAGGCAGAGCTGG + Intronic
916739292 1:167634221-167634243 ATTAGAACACTAGGCAGAACTGG + Intronic
917615651 1:176741248-176741270 ACTCAAACCTCAAGCAGAGCTGG + Intronic
919653354 1:200172878-200172900 ATTAGAAAATAAAGCAGGGCAGG + Intronic
923519265 1:234723363-234723385 ACTAGTTCATGAATCAGAGCAGG + Intergenic
924562585 1:245169503-245169525 ACAAGAGCATTCAGCAGAGAAGG + Intronic
1063676119 10:8141703-8141725 ACAAGAAAGTTAAGCAGAGTGGG - Intergenic
1065543861 10:26798766-26798788 CCTAGAACACTTAGCAGAACAGG + Intronic
1065715724 10:28565532-28565554 ACTAGAACATTAAGCAGAGCTGG - Intronic
1066761681 10:38760449-38760471 ACTAGAACATGAGGCTGAGGTGG - Intergenic
1066959906 10:42211972-42211994 ACTAGAACATGAGGCTGAGGTGG + Intergenic
1069999207 10:72363742-72363764 ACAAGAACACTTAGAAGAGCAGG - Intergenic
1078434146 11:11310672-11310694 ACTGGGAATTTAAGCAGAGCTGG - Intronic
1081206743 11:40284266-40284288 ACTAAAACATTTAGCATGGCAGG + Intronic
1083001356 11:59294278-59294300 TCTTGAATATTAAGCAGAACAGG - Intergenic
1085184407 11:74563252-74563274 AGTAGAACATTAAACTAAGCAGG - Intronic
1085471644 11:76762120-76762142 AATATAACCTTAAGAAGAGCTGG + Intergenic
1086743168 11:90392646-90392668 ACTAGAAAATCTAGCAGAGATGG + Intergenic
1099705049 12:86141682-86141704 ACTTGAACATTAGGTATAGCTGG - Intronic
1100673274 12:96839146-96839168 ACTAGAAAATAGAGCTGAGCTGG - Intronic
1101206964 12:102498216-102498238 CCTAGAGCTTCAAGCAGAGCTGG + Intergenic
1108823104 13:54377866-54377888 ACTAGTACATCACGCATAGCAGG + Intergenic
1109558154 13:64008662-64008684 CCTTGCACATAAAGCAGAGCTGG - Intergenic
1111159694 13:84378319-84378341 GGCAGAACATGAAGCAGAGCTGG + Intergenic
1116237836 14:42303467-42303489 ACTAGATCAGTAAGTAGATCTGG + Intergenic
1117329900 14:54702212-54702234 ACCAGCACATTGAGGAGAGCAGG + Exonic
1117449052 14:55833141-55833163 AGTAGTACATTAACAAGAGCAGG - Intergenic
1120540479 14:85744340-85744362 ACTAGCACAATAAACAGAGGTGG - Intergenic
1127694095 15:61427381-61427403 ACTAAAAAATTAAGCAGGCCTGG + Intergenic
1128340607 15:66820289-66820311 ACAAAAACTTTAAGCAGTGCTGG - Intergenic
1130335455 15:82953402-82953424 AGTAGAACTTGAAGAAGAGCAGG + Intronic
1130619457 15:85446761-85446783 ACTAGAGCTTTAAGAAGGGCTGG - Intronic
1130842456 15:87713779-87713801 ACTAAAACAAAAACCAGAGCTGG - Intergenic
1132067411 15:98743682-98743704 TGTAGAACATTAAACAGAGGTGG + Intronic
1134563175 16:15228260-15228282 GCTAAAACATTTAGCAGAGTAGG + Intergenic
1134923706 16:18139889-18139911 GCTAAAACATTTAGCAGAGTAGG + Intergenic
1142911472 17:3097150-3097172 ACTAGAACATTTAACAGACATGG - Intergenic
1142924368 17:3221058-3221080 ACTAGAACATTTAGCAGATATGG + Intergenic
1143416022 17:6751219-6751241 AATGGAACATTAAGAAGAGATGG + Intergenic
1148690993 17:49526846-49526868 ACTAAAAATCTAAGCAGAGCTGG - Intergenic
1151027720 17:70698664-70698686 ATTAGAACAGTGAACAGAGCAGG + Intergenic
1151656387 17:75498189-75498211 ACTTGAGCAGGAAGCAGAGCAGG - Exonic
1156005890 18:32440405-32440427 ATTACAATATTAAGCAGGGCTGG - Intronic
1156570541 18:38247177-38247199 ACTAGAAAATTAAGCAGAGATGG - Intergenic
1161343489 19:3755061-3755083 TCTAGAACAGTGGGCAGAGCTGG - Intronic
928117087 2:28553392-28553414 ACTAAAACACCACGCAGAGCAGG + Intronic
928234253 2:29526182-29526204 ATTAGATCAACAAGCAGAGCAGG - Intronic
933804732 2:85989937-85989959 ATTATAACATAAAGCAGGGCTGG + Intergenic
933944917 2:87277935-87277957 AATGGAACATGAATCAGAGCTGG + Intergenic
934324992 2:92005116-92005138 ACTAGAACATGAGGCTGAGGTGG - Intergenic
935191376 2:100781481-100781503 TCTAAAACAATAAGCAGACCGGG + Intergenic
936335291 2:111583655-111583677 AATGGAACATGAATCAGAGCTGG - Intergenic
937416140 2:121716269-121716291 AATAGAAATTGAAGCAGAGCAGG + Intergenic
938647480 2:133346470-133346492 ACCAGAAATTTAAGCAGCGCTGG - Intronic
939013683 2:136876836-136876858 ACTTGTACACTAAGCAGAGCAGG + Intronic
940459388 2:153943789-153943811 AATAAAACATAAAACAGAGCTGG - Intronic
943816227 2:192259217-192259239 ACTATAACATGAAGAAGAGAAGG - Intergenic
947678976 2:232012146-232012168 ATGAGAACACTAAGCAGAGCAGG - Intronic
947770540 2:232666837-232666859 ACTAGGGCCTTAAGCAGAGGTGG - Intronic
947825290 2:233101963-233101985 ATTAGCACAGTTAGCAGAGCAGG + Intronic
1169000789 20:2166484-2166506 ATTAAAACAATAAGCAGACCAGG - Intronic
1170017075 20:11793330-11793352 AGTAGAACATTAAGCAGTTCAGG + Intergenic
1170816178 20:19716339-19716361 GCTATAATATCAAGCAGAGCAGG - Intronic
1171943221 20:31351047-31351069 ACCAGGACAATAAGCAGAGAAGG + Intergenic
1173840752 20:46155292-46155314 ACTAGAACAATATGCATAGTTGG + Intergenic
1178259941 21:31089389-31089411 ACAAATACATTAAGCATAGCTGG - Intergenic
1179173377 21:38990340-38990362 GCTAGGACGTTAAACAGAGCAGG + Intergenic
1179579790 21:42334498-42334520 ACTAGGACCTTGAGCTGAGCAGG + Intergenic
1180584497 22:16874901-16874923 ACTAGAACATGAGGCTGAGGTGG - Intergenic
1181296232 22:21841717-21841739 CGAAGAACATTAAGCAAAGCTGG + Intronic
1183320467 22:37162335-37162357 ACCAGTACATTAGGCAGAGGAGG - Intronic
951458068 3:22915727-22915749 CCTAGAATAGTAAGCAGAGATGG - Intergenic
951580205 3:24154985-24155007 CCAAGAACATTAACCAGAGTTGG + Intronic
954216563 3:49128098-49128120 AATAAAACATTAATCAGACCAGG + Intronic
954671023 3:52291490-52291512 ACTAGAACAGGAGGCAGGGCAGG - Intronic
960551787 3:118984069-118984091 ACTAGAAGAGGAAGGAGAGCTGG - Intronic
965332429 3:167392521-167392543 ACTAGAACTTTATACATAGCTGG - Intergenic
969037868 4:4269920-4269942 AATAAAACATTAAGTTGAGCTGG + Intronic
972382894 4:38535886-38535908 CCAACAACATGAAGCAGAGCTGG - Intergenic
977408436 4:96631150-96631172 ATTAGAACATCCAGCATAGCCGG - Intergenic
980350596 4:131678868-131678890 ACTAGAATATCAAGTACAGCTGG - Intergenic
981432220 4:144674321-144674343 AGTTTAACATTAAGCAGAGATGG - Intronic
984819590 4:183868794-183868816 ACTAGAACATTCAGTTAAGCCGG - Intronic
986184636 5:5423806-5423828 CCTAGAACACTAGGCAGAGTAGG - Intronic
986639910 5:9862075-9862097 ACCAGATGATAAAGCAGAGCAGG + Intergenic
989544414 5:42656429-42656451 AAAAGAACATTAACAAGAGCTGG - Intronic
993274986 5:85845732-85845754 AATATAATATTAAGAAGAGCTGG - Intergenic
997834538 5:137181629-137181651 AATTAAACATTAAACAGAGCTGG + Intronic
997918639 5:137955571-137955593 AATACAACATTAAGCACAGGAGG + Intronic
1002391317 5:178914579-178914601 ACTACAGCAATAAGCACAGCAGG + Intronic
1003165585 6:3674964-3674986 ACTAGAACATTTAGAAGAAATGG - Intergenic
1008488606 6:52062248-52062270 ACTAGAACATTGAGCTGAGCAGG - Intronic
1013669284 6:112381353-112381375 GCTAGAAAATTAAACAGGGCTGG - Intergenic
1014683464 6:124464533-124464555 ACTATAACATTAAGCAAATTTGG - Intronic
1019352341 7:560465-560487 ACTAAAAGATTAAGCACAGCTGG + Intronic
1020631018 7:10639937-10639959 ACACGAACATAAAGCAGACCTGG + Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1023349272 7:39303441-39303463 ATTAAAACATAAAGCAGGGCTGG - Intronic
1024745644 7:52402932-52402954 ACTTGGACATTAAGCAAAGAAGG + Intergenic
1032636522 7:133714968-133714990 ATTAGAACCATAAGAAGAGCTGG - Intronic
1032736354 7:134696048-134696070 ACACAAAAATTAAGCAGAGCTGG - Intergenic
1034105295 7:148484562-148484584 ACTAGAACAAAAAGCGGAGGGGG - Intergenic
1037713333 8:21373611-21373633 ACTAGAACATCTAGAAGAGATGG - Intergenic
1042958852 8:74281290-74281312 AGGATAACAGTAAGCAGAGCTGG - Intronic
1047452160 8:124974253-124974275 ACTAGAACAGGAAGCAGAGCTGG - Intronic
1051710356 9:19924917-19924939 CCTAGAACAGTCAGAAGAGCTGG - Intergenic
1056854929 9:90118693-90118715 ACTAGAGCAATAATCAGAGCTGG - Intergenic
1056885124 9:90434368-90434390 ACAAGAACATTAAGAAGAATAGG + Intergenic
1057531914 9:95856546-95856568 ACTACAACAGTCAGCAGAACTGG + Intergenic
1057797096 9:98165692-98165714 ACTGGAAGCTTAAGCAGTGCTGG - Intronic
1058142880 9:101376619-101376641 ACTAGAACAGTCAGCAGAGAAGG + Intronic
1190758388 X:53420661-53420683 ACTAGCACATCATGCAGACCAGG + Intronic
1193059873 X:77194242-77194264 ACTAGAAAATTAAGAAGAAATGG - Intergenic
1194015572 X:88615513-88615535 ACTAGAAACTTAAAAAGAGCAGG + Intergenic
1200325967 X:155239676-155239698 ACTAGTACATTGACCAGCGCTGG + Exonic
1200645092 Y:5772682-5772704 ACTATTACATTAAACAGTGCAGG - Intergenic
1200883682 Y:8246568-8246590 ACAAGAACATAAAGAAAAGCAGG + Intergenic