ID: 1065721984

View in Genome Browser
Species Human (GRCh38)
Location 10:28636131-28636153
Sequence GGGCCCAGTGATCCAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065721974_1065721984 22 Left 1065721974 10:28636086-28636108 CCTTGCAGCACCGGGGGCTGTGG No data
Right 1065721984 10:28636131-28636153 GGGCCCAGTGATCCAATGGAGGG No data
1065721978_1065721984 12 Left 1065721978 10:28636096-28636118 CCGGGGGCTGTGGGGAGCAGCAC No data
Right 1065721984 10:28636131-28636153 GGGCCCAGTGATCCAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065721984 Original CRISPR GGGCCCAGTGATCCAATGGA GGG Intergenic
No off target data available for this crispr