ID: 1065722763

View in Genome Browser
Species Human (GRCh38)
Location 10:28642493-28642515
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065722763_1065722766 1 Left 1065722763 10:28642493-28642515 CCGCACCTACCTCTTTCTTCTTC No data
Right 1065722766 10:28642517-28642539 ACTAACACGCTCCTACTCACTGG No data
1065722763_1065722768 8 Left 1065722763 10:28642493-28642515 CCGCACCTACCTCTTTCTTCTTC No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data
1065722763_1065722767 5 Left 1065722763 10:28642493-28642515 CCGCACCTACCTCTTTCTTCTTC No data
Right 1065722767 10:28642521-28642543 ACACGCTCCTACTCACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065722763 Original CRISPR GAAGAAGAAAGAGGTAGGTG CGG (reversed) Intergenic
No off target data available for this crispr