ID: 1065722768

View in Genome Browser
Species Human (GRCh38)
Location 10:28642524-28642546
Sequence CGCTCCTACTCACTGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065722763_1065722768 8 Left 1065722763 10:28642493-28642515 CCGCACCTACCTCTTTCTTCTTC No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data
1065722762_1065722768 11 Left 1065722762 10:28642490-28642512 CCTCCGCACCTACCTCTTTCTTC No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data
1065722764_1065722768 3 Left 1065722764 10:28642498-28642520 CCTACCTCTTTCTTCTTCTACTA No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data
1065722765_1065722768 -1 Left 1065722765 10:28642502-28642524 CCTCTTTCTTCTTCTACTAACAC No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data
1065722761_1065722768 29 Left 1065722761 10:28642472-28642494 CCTTTTTGTCTCATTTAGCCTCC No data
Right 1065722768 10:28642524-28642546 CGCTCCTACTCACTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065722768 Original CRISPR CGCTCCTACTCACTGGAAGG TGG Intergenic
No off target data available for this crispr