ID: 1065731411

View in Genome Browser
Species Human (GRCh38)
Location 10:28712886-28712908
Sequence ATCTGATGGTGCCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065731408_1065731411 -7 Left 1065731408 10:28712870-28712892 CCTCAAGAGACACCGAATCTGAT No data
Right 1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG No data
1065731406_1065731411 12 Left 1065731406 10:28712851-28712873 CCATCTATGAGGAATGGGCCCTC 0: 17
1: 45
2: 122
3: 201
4: 394
Right 1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG No data
1065731407_1065731411 -6 Left 1065731407 10:28712869-28712891 CCCTCAAGAGACACCGAATCTGA No data
Right 1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065731411 Original CRISPR ATCTGATGGTGCCTTGATTT TGG Intergenic
No off target data available for this crispr