ID: 1065731842

View in Genome Browser
Species Human (GRCh38)
Location 10:28716771-28716793
Sequence CTGACAGGTGAAGCCTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065731837_1065731842 21 Left 1065731837 10:28716727-28716749 CCCAAAGTTCTTGTGCTGGGAAC No data
Right 1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG No data
1065731836_1065731842 22 Left 1065731836 10:28716726-28716748 CCCCAAAGTTCTTGTGCTGGGAA No data
Right 1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG No data
1065731840_1065731842 -7 Left 1065731840 10:28716755-28716777 CCTCAGTGTCGTGGTGCTGACAG No data
Right 1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG No data
1065731838_1065731842 20 Left 1065731838 10:28716728-28716750 CCAAAGTTCTTGTGCTGGGAACT No data
Right 1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065731842 Original CRISPR CTGACAGGTGAAGCCTAATG AGG Intergenic
No off target data available for this crispr