ID: 1065734422

View in Genome Browser
Species Human (GRCh38)
Location 10:28738641-28738663
Sequence AACCTTGACCTGCTCTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065734422_1065734427 21 Left 1065734422 10:28738641-28738663 CCGTGGAAGAGCAGGTCAAGGTT No data
Right 1065734427 10:28738685-28738707 TGGTGACATGTGGAGAAGGATGG No data
1065734422_1065734428 24 Left 1065734422 10:28738641-28738663 CCGTGGAAGAGCAGGTCAAGGTT No data
Right 1065734428 10:28738688-28738710 TGACATGTGGAGAAGGATGGTGG No data
1065734422_1065734426 17 Left 1065734422 10:28738641-28738663 CCGTGGAAGAGCAGGTCAAGGTT No data
Right 1065734426 10:28738681-28738703 GCTTTGGTGACATGTGGAGAAGG No data
1065734422_1065734425 11 Left 1065734422 10:28738641-28738663 CCGTGGAAGAGCAGGTCAAGGTT No data
Right 1065734425 10:28738675-28738697 ATTGTTGCTTTGGTGACATGTGG No data
1065734422_1065734423 1 Left 1065734422 10:28738641-28738663 CCGTGGAAGAGCAGGTCAAGGTT No data
Right 1065734423 10:28738665-28738687 GCTCCTTAGAATTGTTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065734422 Original CRISPR AACCTTGACCTGCTCTTCCA CGG (reversed) Intergenic
No off target data available for this crispr