ID: 1065735189

View in Genome Browser
Species Human (GRCh38)
Location 10:28745133-28745155
Sequence ATGTATTCACAGGTGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065735181_1065735189 11 Left 1065735181 10:28745099-28745121 CCTGAGCAGAGACCTGGAAGATC No data
Right 1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG No data
1065735179_1065735189 29 Left 1065735179 10:28745081-28745103 CCTCACTAGCAGAGGAATCCTGA No data
Right 1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG No data
1065735183_1065735189 -1 Left 1065735183 10:28745111-28745133 CCTGGAAGATCTGGAGAAGCCCA No data
Right 1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065735189 Original CRISPR ATGTATTCACAGGTGGAATA GGG Intergenic
No off target data available for this crispr