ID: 1065736560

View in Genome Browser
Species Human (GRCh38)
Location 10:28758296-28758318
Sequence AAGTAGAGACAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065736560_1065736563 7 Left 1065736560 10:28758296-28758318 CCTTCCTCCTTCTGTCTCTACTT No data
Right 1065736563 10:28758326-28758348 TCTGTTCCTGCTTATCCCATTGG No data
1065736560_1065736567 30 Left 1065736560 10:28758296-28758318 CCTTCCTCCTTCTGTCTCTACTT No data
Right 1065736567 10:28758349-28758371 TCCTGTCTTAAGTTATCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065736560 Original CRISPR AAGTAGAGACAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr