ID: 1065742225

View in Genome Browser
Species Human (GRCh38)
Location 10:28807474-28807496
Sequence CATGTTCCTAACCTATTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065742223_1065742225 13 Left 1065742223 10:28807438-28807460 CCAATCGCTTTATCATTAAAAGC No data
Right 1065742225 10:28807474-28807496 CATGTTCCTAACCTATTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065742225 Original CRISPR CATGTTCCTAACCTATTTAT GGG Intergenic
No off target data available for this crispr