ID: 1065746264

View in Genome Browser
Species Human (GRCh38)
Location 10:28845299-28845321
Sequence GTTTTCAAGGGGATTATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065746249_1065746264 14 Left 1065746249 10:28845262-28845284 CCCTCAAATCCATCTCCCCGAAG No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data
1065746253_1065746264 -1 Left 1065746253 10:28845277-28845299 CCCCGAAGAGTTCTAGGCTGAGG No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data
1065746251_1065746264 5 Left 1065746251 10:28845271-28845293 CCATCTCCCCGAAGAGTTCTAGG No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data
1065746255_1065746264 -2 Left 1065746255 10:28845278-28845300 CCCGAAGAGTTCTAGGCTGAGGT No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data
1065746250_1065746264 13 Left 1065746250 10:28845263-28845285 CCTCAAATCCATCTCCCCGAAGA No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data
1065746256_1065746264 -3 Left 1065746256 10:28845279-28845301 CCGAAGAGTTCTAGGCTGAGGTT No data
Right 1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065746264 Original CRISPR GTTTTCAAGGGGATTATGGG GGG Intergenic
No off target data available for this crispr