ID: 1065746792

View in Genome Browser
Species Human (GRCh38)
Location 10:28849384-28849406
Sequence AGGAATTATACCCATAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065746792_1065746799 23 Left 1065746792 10:28849384-28849406 CCAAGTCTATGGGTATAATTCCT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1065746799 10:28849430-28849452 TATTCAAGTGACTCTACTCTGGG No data
1065746792_1065746800 24 Left 1065746792 10:28849384-28849406 CCAAGTCTATGGGTATAATTCCT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1065746800 10:28849431-28849453 ATTCAAGTGACTCTACTCTGGGG No data
1065746792_1065746798 22 Left 1065746792 10:28849384-28849406 CCAAGTCTATGGGTATAATTCCT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1065746798 10:28849429-28849451 TTATTCAAGTGACTCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065746792 Original CRISPR AGGAATTATACCCATAGACT TGG (reversed) Intronic
909369031 1:74862302-74862324 AGGCATTTTCCCCATTGACTTGG + Intergenic
909468800 1:76003337-76003359 AGGAATTATACCCTCAGAGGGGG + Intergenic
916337893 1:163693649-163693671 AGAAATTATACCCACAGTGTAGG - Intergenic
919840368 1:201604821-201604843 AGAAATTATACCACTTGACTGGG + Intergenic
920758510 1:208758873-208758895 AGGAAATAAACCCATACACAGGG + Intergenic
923266404 1:232318775-232318797 AGAAAATATAGCCACAGACTTGG + Intergenic
923929246 1:238674730-238674752 ATGAAATATTCCCATAGATTGGG + Intergenic
924152482 1:241142722-241142744 AGGCATTTTACCCATTGTCTTGG + Intronic
1064331983 10:14402647-14402669 AGGAATTAAAGCCATCGATTTGG - Intronic
1065746792 10:28849384-28849406 AGGAATTATACCCATAGACTTGG - Intronic
1066063149 10:31742098-31742120 AGGCCTTACACCCATAGCCTTGG - Intergenic
1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG + Intergenic
1072366738 10:94718978-94719000 AGAAAATATCCACATAGACTGGG - Intronic
1074657920 10:115616507-115616529 AGGAATTTTTCCCATTGTCTTGG - Intronic
1077649628 11:3958548-3958570 AGGAGTCATACCCCTAGGCTAGG - Intronic
1079587560 11:22144780-22144802 AGTAAGTATACCCATACACCTGG - Intergenic
1080946366 11:36979308-36979330 AGGAATTTTTCCCATTGTCTTGG + Intergenic
1081034485 11:38125121-38125143 TGGAATTATTCCAATAGAGTGGG - Intergenic
1081278655 11:41182127-41182149 AGCAATTATACTCATAGACCAGG + Intronic
1082699206 11:56407211-56407233 AGCAATGATACCCATAGCATCGG + Intergenic
1082879223 11:58021938-58021960 AGGAATCATACCTCTAGATTTGG - Intergenic
1087165164 11:94995928-94995950 AGGAATTTTCCCCATAGAGAAGG - Intronic
1090761718 11:129842851-129842873 AGTAAAGATACCCATAGAATGGG + Intronic
1091025781 11:132139729-132139751 AGTAATTATACTCACACACTGGG + Intronic
1091707950 12:2712519-2712541 AGGAATTATACCAGTGGGCTAGG + Intergenic
1093772766 12:23036782-23036804 ATGACTTATACACATACACTAGG - Intergenic
1094765255 12:33587305-33587327 AGGTATTAGACCCATAGATCAGG + Intergenic
1095154877 12:38840472-38840494 AGGAATTATACAGAGAGACTTGG - Intronic
1100512117 12:95285696-95285718 AGGAATTAGGCCCAGAGAGTCGG - Intronic
1101035363 12:100700661-100700683 AGGAATAATTCCCATGGAATTGG + Intergenic
1101165281 12:102023827-102023849 TGGAATTCTACCCTTAAACTTGG + Intronic
1101917878 12:108910321-108910343 AGGAATATTTCCCAGAGACTAGG - Intergenic
1103387839 12:120547722-120547744 AGGAAATGTACCCAAAGACTAGG + Intronic
1107174122 13:37380119-37380141 AGCAAAAAAACCCATAGACTGGG + Intergenic
1107259017 13:38468496-38468518 ATGATTTATACTCTTAGACTTGG - Intergenic
1107455485 13:40550758-40550780 AGGAATTATACCTGCATACTGGG - Intergenic
1111053696 13:82920157-82920179 AGGAGTAATACACAGAGACTTGG - Intergenic
1111123965 13:83889180-83889202 ACGTATTATACCCATATTCTGGG + Intergenic
1114457137 14:22863066-22863088 AGGAATTAAGCCCAGAAACTTGG - Intergenic
1116104911 14:40489939-40489961 AGGATTTATTCCAATAGAGTTGG + Intergenic
1117128520 14:52659557-52659579 AGGAATAATACCCCTAGGATTGG + Intronic
1124182750 15:27492199-27492221 AGGACTTAGAGCCACAGACTTGG + Intronic
1125607876 15:40952590-40952612 AAGAATTAAACCCATCGCCTTGG + Intergenic
1128883207 15:71262257-71262279 AGGAATTTTTCTCATAGCCTGGG + Intronic
1129491443 15:75929915-75929937 AGCAATTATAACCAAAGACAAGG - Exonic
1131797029 15:96029665-96029687 AGGAATTGTTCTCCTAGACTGGG + Intergenic
1163354420 19:16800547-16800569 ATAAATTATCCCCATAGACTGGG + Intronic
1163636586 19:18439717-18439739 AGGAATGCTACCCAGAGTCTAGG + Intergenic
929229219 2:39541854-39541876 AGGGTTTATACCCATTGACAGGG + Intergenic
931779651 2:65567958-65567980 AGGAGTTATCCCCATATCCTAGG - Intergenic
932169823 2:69543959-69543981 AGGAATTATAGCCTTAGAGTAGG + Intronic
934584241 2:95475746-95475768 AGGATCTATATCCAGAGACTGGG - Intergenic
934595211 2:95600968-95600990 AGGATCTATATCCAGAGACTGGG + Intergenic
934787557 2:97024566-97024588 AGGATCTATATCCAGAGACTGGG - Intergenic
938855962 2:135311049-135311071 AGAAATCAAATCCATAGACTTGG + Intronic
940470280 2:154089201-154089223 AGGAATTTTGCCCATGGAGTAGG - Intronic
940857886 2:158743880-158743902 AGGTCTTATATCCATACACTAGG + Intergenic
942057841 2:172201370-172201392 AGAAATCACACCCATAAACTGGG - Intergenic
943781752 2:191831516-191831538 AGGAATTATATTCATAGGCTAGG + Intergenic
944664047 2:201945003-201945025 AGAAATTAAACACAAAGACTTGG - Intergenic
948391219 2:237612935-237612957 GGGAATTCTAGCCATAGCCTAGG - Intergenic
948469816 2:238170026-238170048 AGGAAATAGACTCATAGACAAGG - Intergenic
1170102526 20:12718170-12718192 AGGGATTATACCTATAAATTTGG + Intergenic
1170528476 20:17265329-17265351 GGGATTTATACCCAAAGAATAGG + Intronic
1171872789 20:30542637-30542659 AGAAATTCCACCCATAGACAGGG - Intergenic
1174847379 20:53955842-53955864 AGGAATTATGCCAATAATCTTGG - Intronic
1177473968 21:21594328-21594350 AGGCATTTTCCCCATAGTCTTGG + Intergenic
1183001101 22:34859861-34859883 AGGCATTAGACCCAAAGCCTGGG - Intergenic
1185111677 22:48903616-48903638 AGCAGTTAAATCCATAGACTGGG + Intergenic
949661373 3:6283278-6283300 AGGATCTATACCCAGAGAGTAGG + Intergenic
949692428 3:6655221-6655243 AGGCATTTTTCCCATAGTCTTGG + Intergenic
950070895 3:10151740-10151762 AGGAATTGTGCCCAAAGGCTAGG - Exonic
955096628 3:55805181-55805203 AGGAATTAAAAACATACACTTGG - Intronic
956408415 3:68952667-68952689 AGGACTTGTACCCATTGCCTTGG - Intergenic
957882420 3:86237180-86237202 AGGAAATTTACCCAAAGGCTTGG - Intergenic
960803306 3:121559933-121559955 ATTAATTATACCCAAAGACAGGG - Intergenic
965521322 3:169670175-169670197 AGAAATAAAAGCCATAGACTTGG - Intergenic
970997385 4:22282948-22282970 AGGCATTGTCCCCATTGACTTGG - Intergenic
971036083 4:22694191-22694213 AGGGATTTTACCTAGAGACTTGG + Intergenic
972550787 4:40132027-40132049 TGGAATAATACCCACAGATTAGG - Intronic
976382192 4:84412239-84412261 AGTATTAAAACCCATAGACTGGG + Intergenic
978938771 4:114412765-114412787 CTGAATTATACCCAAAGACTCGG - Intergenic
981412036 4:144442957-144442979 AGGCATTTTCCCCATTGACTTGG + Intergenic
982753727 4:159193665-159193687 TGCAATTATACCCAAAGACATGG - Intronic
983225919 4:165086229-165086251 AGGAATTAATCACACAGACTAGG + Intronic
983742478 4:171152634-171152656 AGGACTTATAACCATTTACTTGG - Intergenic
988318331 5:29660278-29660300 AGGTAATATAGACATAGACTTGG - Intergenic
988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG + Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
993309295 5:86309358-86309380 AGGAATAACACACATAGACCAGG - Intergenic
993681503 5:90884088-90884110 AGGATTTATGGCCTTAGACTAGG + Intronic
994808045 5:104477754-104477776 AGAAATTATAGCCTTACACTGGG + Intergenic
994994197 5:107038823-107038845 AGAAACTATACACACAGACTGGG - Intergenic
995724193 5:115167325-115167347 AGACATTTTACCCATAGTCTTGG + Intronic
998854923 5:146385522-146385544 AGAAATTATAGCCAAAGAATGGG + Intergenic
1002479798 5:179492646-179492668 GGGGCTTATACCCAGAGACTAGG + Intergenic
1002479866 5:179492989-179493011 AAGATTTATACCCAGAGCCTAGG + Intergenic
1004115627 6:12764645-12764667 AGGAATTTTATCCATATCCTAGG - Intronic
1004331507 6:14726224-14726246 ATGAACTATTCCCACAGACTGGG + Intergenic
1005672471 6:28121054-28121076 AGGAATTATACCCTTTTACAAGG + Intergenic
1008749268 6:54712285-54712307 TGGAATTACATCCATAGACAAGG + Intergenic
1009757262 6:67956161-67956183 AGTAATTATCCCCATTGTCTTGG - Intergenic
1018168983 6:161129059-161129081 AGGAATGATTCCAACAGACTAGG - Intergenic
1020783891 7:12550081-12550103 AAGAATGATACTCATATACTAGG + Intergenic
1021885649 7:25135989-25136011 AGGAATTATGGCCATAGAATTGG + Exonic
1027459072 7:78429518-78429540 AGGGATTAAACCCACAGCCTTGG + Intronic
1028676726 7:93472771-93472793 AGGATTTAGACCCAAAGACATGG + Intronic
1028816266 7:95149035-95149057 AGGAATTATATACAGAGACCAGG + Intronic
1029619590 7:101681692-101681714 AGGAATTTTCCCCACAGCCTAGG - Intergenic
1030793957 7:113764135-113764157 AGGAATTATACTCATTGTATGGG - Intergenic
1031299131 7:120042407-120042429 AGGCATTTTACCCATGGTCTTGG - Intergenic
1032450315 7:132024977-132024999 AGCAATGAAAACCATAGACTTGG + Intergenic
1036142709 8:6223236-6223258 AGGAATTAAGCCCATAGAGCAGG + Intergenic
1038302262 8:26363424-26363446 AGGAATAATACCAATAAACCTGG + Intronic
1038998862 8:32957139-32957161 AGAACTTATTCCCATTGACTGGG - Intergenic
1042406105 8:68407063-68407085 AGGAATCATACCCATAGAACTGG + Intronic
1047177183 8:122553088-122553110 AGGAATTAGTCCCATAGGATAGG + Intergenic
1047362478 8:124181924-124181946 AAAAATTAGACCCATTGACTGGG + Intergenic
1052771955 9:32698082-32698104 AGGAATTATTCCCAGAGATTTGG + Intergenic
1061598305 9:131647080-131647102 AGGAAATTTAGCCATATACTGGG - Intronic
1186881059 X:13866791-13866813 ACAAATTATACCCAGATACTTGG + Intronic
1187761958 X:22597081-22597103 AGGAATGATGCCTCTAGACTTGG - Intergenic
1188592246 X:31852058-31852080 AGGAATGATAGTCATAGAGTTGG + Intronic
1188848634 X:35104593-35104615 AGGAATCATACCCATAAATTTGG - Intergenic
1198690556 X:139279590-139279612 AGGAATTGTGCCCAGAGAGTTGG - Intergenic