ID: 1065747677

View in Genome Browser
Species Human (GRCh38)
Location 10:28857176-28857198
Sequence GTGTGGTGATGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 516}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065747677 Original CRISPR GTGTGGTGATGGAGAGAAGT GGG (reversed) Intronic
900839866 1:5039821-5039843 AGGGGGTGAAGGAGAGAAGTGGG - Intergenic
902736339 1:18403775-18403797 GTGTGGAGATGGACAGACATAGG - Intergenic
902912183 1:19607843-19607865 GTGTGGTGTTGGAGAAGAGCTGG + Intronic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903172991 1:21565115-21565137 GTCTGGTGGTGGAGAGAAAGAGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903721496 1:25408877-25408899 GTGGGGAGATGGTGAGAAGGAGG + Intronic
903846229 1:26281145-26281167 GTGTGGTGATGGAGTCCAGCAGG - Exonic
904309385 1:29617949-29617971 GGGTGGTGATGAAGAAAGGTTGG + Intergenic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
905624352 1:39477647-39477669 AGGTGGTGATGGAGAGAGCTAGG + Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906779221 1:48557497-48557519 GTGATGTGATGAAGAGAAGGAGG + Intronic
907334102 1:53689224-53689246 GTGCTGTGATGGAGCGAAGCAGG + Intronic
907744159 1:57196028-57196050 GGGTGGTGATGGGGAGTAGGAGG + Intronic
908663763 1:66466425-66466447 GTGTGGTGAAGAGGAGTAGTAGG - Intergenic
908732489 1:67240604-67240626 GTGTAGTAAAGGAGAGAAATGGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909094084 1:71265680-71265702 GTGGGATGAGGGAGAGAAGCAGG - Intergenic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
910433820 1:87184988-87185010 GAGTAGTGACGGAGAGATGTTGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
910937365 1:92495303-92495325 TTGTGATTAAGGAGAGAAGTGGG - Intergenic
911426219 1:97716612-97716634 GTGTGGTGATGGAGGGATCTAGG - Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
916021937 1:160800314-160800336 GGGGGATGATGAAGAGAAGTGGG - Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917247186 1:173016709-173016731 GTGTGGTGGTGGTGAGAGGAGGG + Intergenic
917471999 1:175333954-175333976 GTTTGGTGTTGGAGAGGAGTCGG + Intronic
918113234 1:181476348-181476370 GTGTGGTGATGGACAGGTGGTGG + Intronic
918164852 1:181935421-181935443 GTGGGGTGGAGGAGAAAAGTGGG - Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
920528800 1:206686374-206686396 GTGTGGTGGTGGGGAGAATAAGG + Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923312713 1:232751305-232751327 GGGTGGTAATGGAGTGAACTTGG - Intergenic
923515932 1:234698131-234698153 GTTTGGTGATGAAGAGAAGGAGG - Intergenic
923552459 1:234974934-234974956 GTGTGGCTATGGGGATAAGTGGG + Intergenic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
924426882 1:243959338-243959360 GTGTGGTGACGGAGAATATTAGG + Intergenic
1064179813 10:13104644-13104666 GTGTGGAGATGGCGACTAGTGGG - Intronic
1064691103 10:17919256-17919278 GTTTTGTGATGGAGAAAAGTCGG - Intergenic
1064884168 10:20091229-20091251 GTATGCTGGTGGTGAGAAGTGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1066255906 10:33678718-33678740 TTGTGGTGATGCAGTCAAGTAGG + Intergenic
1066348247 10:34610886-34610908 GTGTGGTGATGGGGAGAGGTGGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070972512 10:80579135-80579157 GCCTGGTGATGGAGAGAGATGGG + Intronic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071337294 10:84611399-84611421 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073380179 10:103072412-103072434 GCCTGGTGGTGGGGAGAAGTAGG - Intronic
1073866255 10:107807810-107807832 TTGTGGTGATGGTGAGATTTAGG + Intergenic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1074370800 10:112899302-112899324 GTGTGGTTAGGGAGAGAACTGGG - Intergenic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1079072443 11:17359321-17359343 ATGTGGTGATGGACTAAAGTTGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1080815519 11:35752647-35752669 GCATGGGGATGGAGAGAGGTAGG - Intronic
1081197333 11:40177458-40177480 ATATAGTGAGGGAGAGAAGTCGG - Intronic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081721843 11:45295092-45295114 GTGCTGTGATGGAAAGAAGGTGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083844604 11:65323849-65323871 GTGTGATGAAGGAAAGAACTGGG + Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084097092 11:66918708-66918730 GTGTGGGTATAGAGATAAGTAGG + Intronic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085534460 11:77209674-77209696 AGGTGGTGATGGAGAGACATGGG - Intronic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086303118 11:85451292-85451314 GTCTGCTGTTGGAGAGAAGTGGG - Intronic
1087045852 11:93843283-93843305 GTGTGTTGCTGGAGAGAAACAGG - Intronic
1088952019 11:114581410-114581432 TTGTGGTGAGGTAAAGAAGTGGG + Intronic
1089054557 11:115575052-115575074 GAGGGGTGGTGGAGAGAAGATGG + Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1090130617 11:124137730-124137752 GTGGGGTCAGGGAGAGAAATGGG - Intronic
1091108524 11:132944110-132944132 GTGTCGGGACGGAGCGAAGTGGG - Intronic
1091646386 12:2275337-2275359 GTTGGGTGATGGTGAGGAGTCGG - Intronic
1092123223 12:6058670-6058692 GGGTGATGATGGATAGGAGTAGG + Intronic
1092376926 12:7963494-7963516 GTGTGGTGATAGACAGGTGTTGG - Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1093737986 12:22645845-22645867 GGGGGGTGATGAAAAGAAGTTGG - Intronic
1094339224 12:29392107-29392129 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1094509815 12:31089464-31089486 GTGTGGACATGCAGAGAAGCAGG + Exonic
1095106285 12:38237075-38237097 GTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095406968 12:41877391-41877413 GTGGGGTACTGGAGAGATGTTGG + Intergenic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096102279 12:48977205-48977227 GTATGGTGATGGAGAGGACTGGG - Intergenic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096398594 12:51286757-51286779 CTGTGCTGATGGAGAGAGATAGG - Intronic
1096642731 12:53006946-53006968 GTGTGGTGGGGGGGAGCAGTTGG + Intronic
1096770423 12:53932826-53932848 GTCTGGTCATGGAGAGAGCTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1097218157 12:57430521-57430543 GTGCGCTGCTGGAGAGAAGCTGG - Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097405007 12:59178241-59178263 GTGTGATTATGGAAAGAACTAGG - Intergenic
1097583489 12:61486903-61486925 GTGGGGGGAGGGAGAGGAGTGGG + Intergenic
1097687547 12:62704881-62704903 GCGTGCTGATAGGGAGAAGTGGG - Intronic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099406454 12:82269467-82269489 TTGTGGTGAAGGTGAGAGGTAGG + Intronic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1101118432 12:101554359-101554381 GTGTGGTGATGGGCACGAGTTGG - Intergenic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1102241300 12:111326131-111326153 GTGTTGTGATGGGGAGGGGTTGG + Intronic
1103217948 12:119217821-119217843 GTCTGGTAAGGGAGGGAAGTAGG - Intronic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1104615793 12:130267476-130267498 GTGGGGAGATGAAGAGAGGTTGG - Intergenic
1104706952 12:130954784-130954806 GTGTGGTGAGGCAGTGAGGTCGG - Intronic
1104781310 12:131422215-131422237 GTGTGCTGATGGTGGGCAGTAGG + Intergenic
1105073480 12:133252897-133252919 GTGTGGTGATGTTGACAGGTTGG + Intergenic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105911622 13:24873678-24873700 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1106011051 13:25823590-25823612 GTGTACTGCTAGAGAGAAGTAGG + Intronic
1106140117 13:27005070-27005092 GTGGGGTGATGGGGAGGAGGCGG - Intergenic
1106285938 13:28318098-28318120 GTGTGGTGATGGTGAGCACCTGG - Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106561242 13:30848116-30848138 GGGTCTTGATGGAGACAAGTAGG + Intergenic
1107397914 13:40037369-40037391 ATGTGGTGATGGTGAAAGGTAGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108624168 13:52211168-52211190 GTGTGGTGTGGGGGAGAAGATGG - Intergenic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112542551 13:100329949-100329971 GTGTTGTTATGGAGAAAAATTGG - Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1113042134 13:106115945-106115967 GTGTGGGGAGGGAGAGCATTAGG - Intergenic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116907050 14:50414391-50414413 GTTTGGGGATGGGGAGATGTTGG - Intronic
1117164340 14:53018697-53018719 GAGGGATGATGAAGAGAAGTGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117996960 14:61487094-61487116 GGGTGGTGCTGGAGATAAGTGGG + Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118676952 14:68196459-68196481 GTGTGAAGATGTGGAGAAGTAGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119750208 14:77071990-77072012 GTGTGGTGGTGGTGGGAGGTGGG - Intergenic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1120386263 14:83850049-83850071 GTTTGGTGTTGGGGAAAAGTGGG + Intergenic
1121507993 14:94490977-94490999 GTATGGGGATGGAGTGAAGGTGG - Intronic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122976993 14:105174791-105174813 GGGGCGTGATGGAGTGAAGTTGG - Intronic
1123962123 15:25414474-25414496 GTGTTGTGATGGAGAGATACAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1126859491 15:52870293-52870315 GTATGGTGATGGAGAGAAGGGGG + Intergenic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127082563 15:55394898-55394920 GAGGGGTGAGGAAGAGAAGTTGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128255464 15:66192926-66192948 GTGGTGTGATGGAGAGGAATAGG + Intronic
1128261112 15:66233687-66233709 GAGTCATGTTGGAGAGAAGTGGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1132026248 15:98406504-98406526 GTGTGGTGACGGAGACAAGTAGG - Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1133219940 16:4315720-4315742 GAGGGGTGAGGGAGGGAAGTGGG - Intronic
1133729355 16:8566673-8566695 GAGGGTTGATGGAGAGAAATAGG - Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135881655 16:26263516-26263538 GTGTGGTGATGTTGAGAGGTGGG - Intergenic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139371174 16:66470307-66470329 GTGAGGTGATGGATAGATGGAGG + Intronic
1140092913 16:71852014-71852036 GTGTTGTGATGGGGAGCAGCAGG + Exonic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1141539524 16:84708938-84708960 GGGTAGTGAGGGAGAGAAGCAGG + Intronic
1141708040 16:85680134-85680156 GTGTGGTGCGGGAGAGATGTGGG - Intronic
1142002633 16:87672129-87672151 GTGGGGTGAGGGAGAAGAGTGGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143156434 17:4840233-4840255 GTTTGGTGATGGTGAGAATTGGG + Intronic
1143868494 17:9941080-9941102 GTGCGATGATGGAGAGAGGGCGG + Intronic
1145276951 17:21437245-21437267 GTGGGGTCATGGAGAGGAGCCGG + Intergenic
1146551385 17:33783094-33783116 GTGTGGTGATGGAAAGTGATGGG - Intronic
1146695246 17:34903926-34903948 GTGGGGTGAAGGAGAGAAGATGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147711359 17:42468513-42468535 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1147986213 17:44308967-44308989 GGGTGGTGAGGGAGAGGGGTTGG + Intronic
1148202371 17:45757824-45757846 GTGCTGTGATGAAGAGCAGTTGG + Intergenic
1148220109 17:45855178-45855200 ATGTGGTGATGGAGACAGATTGG + Intergenic
1149766273 17:59281250-59281272 GTGTGGAGATGGCGACTAGTAGG + Intergenic
1149781252 17:59398181-59398203 GTGTGGTGAGGGAGGGGACTGGG + Exonic
1149891126 17:60391721-60391743 GTGTGGTGGAGGAGAGAGGTCGG - Intronic
1149901946 17:60488494-60488516 GCCTGGTGTTGGAGAGAAATGGG + Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150846866 17:68667729-68667751 GGGGGGTGATGGAGAGAGATTGG - Intergenic
1151215578 17:72574639-72574661 GAGTGGTGGAGGAGAGATGTTGG - Intergenic
1151552422 17:74829823-74829845 GTGTGGGGCTGGAGAGAGTTGGG - Intronic
1152056124 17:78028254-78028276 TTCTGGGGATGGGGAGAAGTGGG + Intronic
1152494959 17:80664527-80664549 GTGGGGTGAGGAAGAGAAGAAGG - Intronic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153948409 18:10037012-10037034 GTGTGGTGTTGGAGAGTTGTGGG + Intergenic
1155364967 18:25040566-25040588 GTGGGGTGAAGGACAGAAGGAGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156396622 18:36705181-36705203 GTGTGTTGATGGAGGGATCTGGG - Intronic
1156452697 18:37275423-37275445 GAGGGGCGAGGGAGAGAAGTAGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1159327270 18:66938460-66938482 GAGTGGTAAGGAAGAGAAGTGGG - Intergenic
1159637868 18:70827365-70827387 GTGAGGTGATGCAGGGAATTAGG + Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160205019 18:76824368-76824390 GTGGGCTGCTGGAGAGATGTTGG + Exonic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1161723492 19:5915977-5915999 GGGTGGTGGTGGAGAGAACAGGG + Exonic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1164384545 19:27761824-27761846 GTGTGATGATAGAGACAATTGGG - Intergenic
1164763813 19:30747708-30747730 GTGTGCTCAGGGAGAGTAGTGGG + Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165407732 19:35641375-35641397 GTCTGGAGAAGGAGAGCAGTGGG + Intergenic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926777848 2:16439837-16439859 GTGTGGTGATGGAATGATGGGGG + Intergenic
927231210 2:20825882-20825904 GTGTGGTGATGTTCAGAAGTGGG - Intergenic
928142412 2:28741286-28741308 GGATGGTGTTGAAGAGAAGTTGG + Intergenic
928199967 2:29241515-29241537 GTGTGGTGATGGGGTGAGGAAGG + Intronic
928656296 2:33455041-33455063 ATGTGGTGATGGAGGAGAGTGGG + Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929933764 2:46278209-46278231 GGCTGGTGAAGGGGAGAAGTAGG - Intergenic
930263373 2:49172191-49172213 GAATGATGATGGAGAGAGGTGGG + Intergenic
931804179 2:65788636-65788658 GGGAGGTGATGGACAGAAGGTGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931913703 2:66930086-66930108 GGGTTGTGATGGAAAGAACTTGG - Intergenic
931928081 2:67096984-67097006 GTGTGGTAATGGAGAGGATCTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932693341 2:73932247-73932269 GTGGGGTGATGAAGAGTAGTGGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
934988179 2:98902221-98902243 GTGTAGTCATGGACACAAGTGGG + Intronic
936273031 2:111066440-111066462 GTGTGGTGATGGAGATGATCTGG + Intronic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936855267 2:116950162-116950184 GTGGGGTGATGAATAGAGGTTGG - Intergenic
937065701 2:119015518-119015540 GTGTGGGGAGGGAGAGCACTGGG - Intergenic
937219412 2:120333186-120333208 GGGTGTTGATGAAGAGAAGAGGG - Intergenic
938790157 2:134669313-134669335 GTGTGATGAAGGATAGAACTAGG - Intronic
943013907 2:182487657-182487679 GTGTGGGGATGGGTAGGAGTGGG + Intronic
944393855 2:199247527-199247549 GAGTGGTGAGTGAGAGAGGTTGG - Intergenic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946306059 2:218857677-218857699 GGGTGGTAATGGAGAGAGGCTGG + Intergenic
946554281 2:220837276-220837298 GAGGGGTGAAGGAGAGAAGCAGG + Intergenic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169425292 20:5492085-5492107 GTGTGGTGTTGGCTAGATGTGGG - Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170914352 20:20608237-20608259 GTGTGTTGGTAGAGTGAAGTAGG - Intronic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171310755 20:24143077-24143099 GTCTGGTGATGGAGGCAAATGGG - Intergenic
1172581004 20:36048085-36048107 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1173143994 20:40509481-40509503 GTATGGTGATGATGAGAAGGGGG - Intergenic
1173601862 20:44301014-44301036 GTGTGTTGATGTAGAGAAAAAGG + Intergenic
1174753125 20:53131960-53131982 GAGTGGTGAAGGAGAGTAGAGGG + Intronic
1175110216 20:56642596-56642618 GACAGGTGATGGAGTGAAGTCGG + Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177154265 21:17485635-17485657 GTGGGGTGACGGTGAGGAGTGGG - Intergenic
1177435040 21:21040780-21040802 GTGGGGTGATAGGGAAAAGTTGG + Intronic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177733852 21:25063820-25063842 ATGGGGTCATGGGGAGAAGTTGG - Intergenic
1178009161 21:28262947-28262969 GGGAGGTGATGGACAGAAATTGG - Intergenic
1178188905 21:30257735-30257757 GTTTGCTGGTGAAGAGAAGTTGG - Intergenic
1182232617 22:28850014-28850036 GGGGGGTGATGAAGAGAGGTGGG - Intergenic
1182392818 22:30013415-30013437 GTGTGGTCATGGGGAGAACTCGG + Exonic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1183297588 22:37040378-37040400 CTGTGGTGCTGGACTGAAGTTGG + Intergenic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184388071 22:44187560-44187582 GGTTTGTGATGGAGAGAAGCAGG + Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185177426 22:49336074-49336096 GTGCAGTGATGGAGAGCAGCTGG - Intergenic
949696244 3:6699465-6699487 GTGTGGTGATGGGGAGCCGCAGG - Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950284020 3:11730834-11730856 ATGTGGTGGTGCAGAGAAGATGG - Intergenic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952449074 3:33413819-33413841 GTCAGGTGATGGTGTGAAGTGGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953589051 3:44233992-44234014 GGTTGGTGATGGAGAGATGCTGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953782431 3:45883500-45883522 GTCTGGTGATTAAGAGAAGATGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954506050 3:51074684-51074706 GTGAGGGGAGGGAGAGAATTAGG + Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956331336 3:68113291-68113313 AGGTGGTGCTGCAGAGAAGTAGG + Intronic
956373825 3:68592664-68592686 GTGGGGGGAGGGAGAGAATTAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957124926 3:76146847-76146869 GTGTGGTGGAGGGGAGAGGTGGG - Intronic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957699901 3:83695377-83695399 GTGGGGTGTTGGGGAGAAGTAGG + Intergenic
957940551 3:86997377-86997399 GTGAGGTGATGGAGCAAAATAGG - Intergenic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
958196519 3:90247932-90247954 GTGTGGTAAGAAAGAGAAGTGGG - Intergenic
958419709 3:93916569-93916591 GTGTGGTAAGAAAGAGAAGTGGG - Intronic
959015291 3:101127145-101127167 GTTTGATGATGGAGGGAGGTGGG + Intergenic
959702190 3:109308992-109309014 GTGTGTTGATGGTGTGAAGGTGG - Intronic
959753129 3:109862302-109862324 GGGAGGTGAGGGAGAGAAGAGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960930915 3:122848945-122848967 GTGGGAGGATGAAGAGAAGTTGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961555429 3:127693687-127693709 GGATGATGATGGAGAGGAGTCGG - Intronic
962281868 3:134058199-134058221 GTGTGGTGTCGGAGAGCTGTGGG - Intergenic
962442463 3:135434976-135434998 GTGTGTTGATGGACATAGGTTGG - Intergenic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962828800 3:139121870-139121892 GTGAAGTGATGGAAAGAAATGGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
966316843 3:178656895-178656917 GGGTGGTAAAGGAGACAAGTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967232067 3:187348759-187348781 GGGTGGTGAAGGGGAGATGTTGG + Intergenic
967697387 3:192548160-192548182 GTATGCTGAGGGAGAGAAGAAGG + Intronic
968850725 4:3075574-3075596 GTTTGGAGCTGGAGAGATGTGGG + Intronic
969115636 4:4869168-4869190 GTGTGGTGGGGGGGAGGAGTGGG + Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969875502 4:10133067-10133089 GTGTGGGGATGGACACAAGGTGG + Intergenic
969951386 4:10839937-10839959 TCGTGATGATGCAGAGAAGTTGG - Intergenic
973616527 4:52684189-52684211 GTGGGGTGGTGGAGAGCATTAGG + Intergenic
973844868 4:54901367-54901389 GTGTGATGAAAGAGAGAGGTAGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
975656589 4:76647277-76647299 TGGTGGTGATGAAGAGATGTTGG + Intronic
975695026 4:77004022-77004044 ATATGATGATGGAGAGAAGCAGG - Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
977457230 4:97276724-97276746 GCGTGGTGATGATGAAAAGTAGG - Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980625882 4:135374303-135374325 GTGAGGTGAGGGAGAGCATTAGG - Intergenic
981026990 4:140086701-140086723 GTGGGGTGAACGAGAGAAGAGGG + Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981723330 4:147823380-147823402 GTGTGGAAAGGGAGAGAACTTGG + Intronic
981832089 4:149013675-149013697 GTGTTGTGATGCAGAAGAGTTGG + Intergenic
982275046 4:153629794-153629816 GTGGGGAGATGGGGAGAAGCTGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
985812289 5:2098992-2099014 GTGTGGGGCTGCAGAGGAGTTGG - Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986229147 5:5845538-5845560 CTGTGGTGATGCAGAGGCGTGGG - Intergenic
986572872 5:9183127-9183149 GTGTGGTGAGGGAAAGGAATAGG + Intronic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
989234785 5:39134093-39134115 GTTTAGTGATAGAGAGCAGTAGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991238997 5:64434792-64434814 GTGTATTAATGCAGAGAAGTTGG - Intergenic
992093365 5:73339064-73339086 GTGTGGTGGAGGAGAGATGATGG + Intergenic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993625529 5:90220157-90220179 GGGTGGTGATGGTTTGAAGTTGG + Intergenic
995123111 5:108556090-108556112 GTGTGGTGATGGATTGGAGGGGG + Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995911827 5:117196705-117196727 GAGTAGTGAGGAAGAGAAGTGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996846863 5:127909215-127909237 GTGTGGTGAGGCAGTGAAATTGG - Intergenic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
997883516 5:137611457-137611479 GTGGGGTGAATGAGAGAATTAGG - Intergenic
998456401 5:142277143-142277165 GACTGGTGATGCAGAGAAGCAGG + Intergenic
998531738 5:142891218-142891240 GGGTGGTGGTGGTGAGAAGCAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999671975 5:153966083-153966105 GGGAGATGATGGAGAGAAGAGGG + Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000350946 5:160352379-160352401 GTGTGGTGATGGCGGGTGGTTGG + Intronic
1000937288 5:167317925-167317947 GTGTAGTGATGGAGACATGGCGG - Intronic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001665046 5:173425666-173425688 GTGTGGAGATGAAGAGGTGTGGG + Intergenic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1002462619 5:179382949-179382971 GGGTGGTGATGTTGAGAAGGTGG - Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1004068217 6:12272298-12272320 GTGTGATGAGGCAGAGAAGCTGG + Intergenic
1004591749 6:17058674-17058696 GTGGGGTGGGGGAGAGAGGTGGG + Intergenic
1004655796 6:17659043-17659065 GGGTGTTGTTGTAGAGAAGTAGG - Intronic
1004696643 6:18040263-18040285 TGGTGGTGATGGAGACAAGGGGG + Intergenic
1005472492 6:26175513-26175535 GTGTGTAGATGTAGAGAACTTGG + Intergenic
1005512601 6:26524555-26524577 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1005705770 6:28451241-28451263 GTGTGGGGGTGAAGAGAGGTTGG - Intergenic
1005880200 6:30051753-30051775 GGGGGGTGATGAAGAGAGGTAGG - Intergenic
1006175628 6:32119797-32119819 GTGTTGGGGAGGAGAGAAGTAGG - Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007004090 6:38343585-38343607 TTGTGGTGATGGAGGGTTGTGGG - Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1008434621 6:51461122-51461144 GGGTGGTGAAGGAGTGAAGAGGG - Intergenic
1008554057 6:52657676-52657698 GTGTGGTGATGGAGTCCAGCAGG - Intergenic
1008640414 6:53456634-53456656 GTGTGATGATGGAGAGTCTTAGG - Intergenic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010405501 6:75500998-75501020 GTGGGGAGAGGAAGAGAAGTGGG + Intergenic
1010725414 6:79327273-79327295 GTGTGGTGGTGGTGAGTAGCAGG + Intergenic
1011176098 6:84562172-84562194 GTGTGGTGGTAGAGAGTAGAAGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1012557758 6:100536603-100536625 GTGTGGTGATGGATGGTAGGGGG - Intronic
1012570638 6:100723568-100723590 GTGTGGAAATGTAAAGAAGTAGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014078050 6:117259589-117259611 GTGGGGAGATTGAGAGATGTTGG - Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014589867 6:123250896-123250918 GTGTAGTGTTGGAAAGAAGTGGG - Intronic
1014754460 6:125288044-125288066 GTTTAGTGCTGAAGAGAAGTAGG + Intronic
1015821609 6:137267062-137267084 GTGTGGTGATGTTGGGATGTGGG - Intergenic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1016758203 6:147710177-147710199 TTGAGCTGATGGAGAGCAGTAGG - Intronic
1016832826 6:148450020-148450042 GTGTGGTGATGTTGGGAGGTGGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020152746 7:5696158-5696180 ATGTGGTGACGAAGAGCAGTTGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020986332 7:15139494-15139516 GTGGGAGGAGGGAGAGAAGTAGG - Intergenic
1021140594 7:17019438-17019460 GTGTGGTGAAGGAAAGAGTTGGG + Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021602064 7:22374054-22374076 GTGAGGAGATGGTGAGAAGGTGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021792554 7:24220038-24220060 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1022248822 7:28586636-28586658 GTGGTGTGATAGAGAGAAGTGGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022762408 7:33369662-33369684 CTATGGTGATGGAGAGAGATAGG + Intronic
1022852553 7:34279676-34279698 GTCTGGAGATGGTGAGAGGTGGG + Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1024245663 7:47468020-47468042 GTCTGCAGTTGGAGAGAAGTTGG - Intronic
1024579113 7:50787703-50787725 GTGAGGTGATGGAGCGACGCAGG - Intronic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024898533 7:54289769-54289791 GAGGGGTGATGAAGAGCAGTTGG + Intergenic
1024909528 7:54429190-54429212 GTGTGCTGCTGGAGAGGAGGTGG + Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1027464375 7:78496743-78496765 GGGTGGTGATGATGTGAAGTAGG + Intronic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1030152325 7:106419926-106419948 TGGTGGTGATGGAATGAAGTGGG - Intergenic
1030396431 7:108992384-108992406 ATGAGGTAAGGGAGAGAAGTGGG + Intergenic
1031226984 7:119051819-119051841 GAGGGGTTATGGAGAGATGTTGG - Intergenic
1031766539 7:125785229-125785251 GTGGGATGAGGGAGAGAAATGGG + Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032514405 7:132496024-132496046 GTGTGGGGATGGACAGACCTGGG + Intronic
1032547767 7:132757952-132757974 GTGTGGTGATGTTGGGAGGTGGG - Intergenic
1034397083 7:150835304-150835326 GTGGGGAGATGGGGAGATGTTGG + Intronic
1034620393 7:152452194-152452216 GTGGGGTGAATGAGAGAAGGAGG + Intergenic
1034998233 7:155591779-155591801 GTGTGGCTATGGAGAGAGCTTGG - Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039209151 8:35192126-35192148 TGGGGGTGATGGAGAGATGTTGG - Intergenic
1041110956 8:54481834-54481856 GTGGAGTGATGGAGACAACTAGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041903053 8:63002880-63002902 GTGTGGTGAAGGGGAGGATTTGG + Intergenic
1042081996 8:65064457-65064479 GGGTGGTGTGGGACAGAAGTGGG - Intergenic
1042332940 8:67600369-67600391 GTGGGTGGATGGAGAGATGTTGG + Intronic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1044565723 8:93659489-93659511 GTGTGGAGCTGTAGAGATGTGGG + Intergenic
1044743190 8:95348355-95348377 ATGTGGTGAGAGAGAGGAGTGGG + Intergenic
1045282129 8:100758362-100758384 GTCTGGTGATGGAGCAAGGTAGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045423432 8:102039730-102039752 GTGTGGTGATGTTGGGAGGTGGG + Intronic
1045892239 8:107170577-107170599 GTGTGGTGCTGGAGAGTGCTGGG - Intergenic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1047640037 8:126809078-126809100 GTCAGGTAAAGGAGAGAAGTGGG - Intergenic
1047784603 8:128141801-128141823 GTTTGGTGATGGAGGCAAGAGGG + Intergenic
1047810543 8:128403859-128403881 TTGTGGTGAAGGACAGGAGTCGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048380418 8:133860486-133860508 GGGTGGTGAGGGAGAGAGGGAGG - Intergenic
1048794888 8:138140897-138140919 GTGTTGTGATGAAGAGAACAGGG - Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049716752 8:144096513-144096535 GGGTGGTGCTGGAGAGATGGGGG + Intronic
1050254697 9:3781643-3781665 GGGTGGTGACTGACAGAAGTAGG - Intergenic
1050376542 9:4980093-4980115 GTGTGGTGGTTGGGAGAAGGAGG + Intergenic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1052209314 9:25882896-25882918 GTGAGGAAATGGGGAGAAGTAGG - Intergenic
1053016949 9:34667295-34667317 GTGGGATGAGGGAGAGAAGAGGG - Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1055273598 9:74589354-74589376 GTGTGTTGGGGGAGAGAGGTGGG - Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056857391 9:90144470-90144492 GAGTGGTAATGGGGAGATGTAGG - Intergenic
1056924855 9:90825769-90825791 ATGTGGTTTTGGAGACAAGTAGG + Intronic
1057010358 9:91595971-91595993 GTGGGGAGATGGAGAGAATCAGG - Intronic
1057582397 9:96298918-96298940 GTGGGGTGGGGGTGAGAAGTGGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1058349287 9:104002125-104002147 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059809368 9:117838648-117838670 GTGTGGTGATGGACACCTGTAGG + Intergenic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060991659 9:127853256-127853278 GTGGGGAGGTGGGGAGAAGTTGG + Intronic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1203553021 Un_KI270743v1:180108-180130 GTATAGAGAGGGAGAGAAGTAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186863844 X:13699752-13699774 GTGCGGGGATGGTGAGTAGTAGG + Intronic
1187949785 X:24460490-24460512 GTGGGGGGAGGGAGAGAGGTAGG + Intergenic
1188060611 X:25596417-25596439 GTGGAGTCATGGAGAGAAGCTGG + Intergenic
1188360494 X:29246852-29246874 GTGGGGTGGGGGAGAGTAGTAGG + Intronic
1188384029 X:29533901-29533923 TTCTGGTGATGGTGGGAAGTGGG + Intronic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188821560 X:34781449-34781471 GAGTGGTGTGGGAGAGGAGTTGG + Intergenic
1189084351 X:38004784-38004806 GTGAGGTGCTGGGGGGAAGTAGG + Intronic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1191988894 X:67010673-67010695 GTCTGGTGATGAACGGAAGTGGG - Intergenic
1192226355 X:69230877-69230899 GAGTGCTGAGGCAGAGAAGTAGG - Intergenic
1193397355 X:81001336-81001358 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1193418828 X:81258595-81258617 GTGTTTTGGTTGAGAGAAGTGGG + Intronic
1195393752 X:104389292-104389314 TTGAGCTGATGGAAAGAAGTAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195563647 X:106315916-106315938 GTGGGGTGGGGGAGAGAGGTTGG + Intergenic
1195576862 X:106461161-106461183 TTGTGGTAATAGTGAGAAGTGGG + Intergenic
1196161776 X:112492901-112492923 GTGGGGTGATGGGGAAAAGTGGG - Intergenic
1196246974 X:113411808-113411830 GTGTGGTGGTGTTGAGAAGCAGG - Intergenic
1196271227 X:113713666-113713688 TTGTGGTGGTGGTTAGAAGTGGG - Intergenic
1196404879 X:115350628-115350650 GAGAGGTGATGGTGAGAAGCAGG + Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1196856120 X:119986630-119986652 GGGGGATGATGAAGAGAAGTCGG + Intergenic
1196858435 X:120005294-120005316 GGGGGATGATGAAGAGAAGTGGG - Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198305909 X:135382943-135382965 TTGTAGTGATGGAGTGGAGTGGG - Intergenic
1198440848 X:136661542-136661564 GTGCAGTGAGGGAGAGAAATGGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1200042727 X:153381416-153381438 TTGGGCTGAAGGAGAGAAGTAGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201704575 Y:16922132-16922154 GTGAGGTGAGGGAGAGCATTGGG - Intergenic
1201912821 Y:19150659-19150681 GTCTGCAGAGGGAGAGAAGTAGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic