ID: 1065758519

View in Genome Browser
Species Human (GRCh38)
Location 10:28958852-28958874
Sequence GTAGGGAGAAGGAGGTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065758510_1065758519 25 Left 1065758510 10:28958804-28958826 CCTCATAGAAGTAGAAAGTAGAA No data
Right 1065758519 10:28958852-28958874 GTAGGGAGAAGGAGGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065758519 Original CRISPR GTAGGGAGAAGGAGGTTAAG GGG Intergenic
No off target data available for this crispr