ID: 1065759212

View in Genome Browser
Species Human (GRCh38)
Location 10:28966356-28966378
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065759206_1065759212 -8 Left 1065759206 10:28966341-28966363 CCTCTAATCCCAGCACTTTGGAA 0: 104
1: 13743
2: 331477
3: 259315
4: 136683
Right 1065759212 10:28966356-28966378 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065759212 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr