ID: 1065759328

View in Genome Browser
Species Human (GRCh38)
Location 10:28967257-28967279
Sequence GTCTCCTGAAAAATGACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065759328_1065759329 -7 Left 1065759328 10:28967257-28967279 CCTTATGTCATTTTTCAGGAGAC No data
Right 1065759329 10:28967273-28967295 AGGAGACTGAATTTGAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065759328 Original CRISPR GTCTCCTGAAAAATGACATA AGG (reversed) Intergenic
No off target data available for this crispr