ID: 1065763601

View in Genome Browser
Species Human (GRCh38)
Location 10:29006514-29006536
Sequence CTCTGGTTACCAACTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065763601_1065763607 -2 Left 1065763601 10:29006514-29006536 CCTCCCTTAGTTGGTAACCAGAG No data
Right 1065763607 10:29006535-29006557 AGGTCTCAATGTAACTGGACAGG No data
1065763601_1065763608 20 Left 1065763601 10:29006514-29006536 CCTCCCTTAGTTGGTAACCAGAG No data
Right 1065763608 10:29006557-29006579 GAATAAAGAGTGTCTCCAAGTGG No data
1065763601_1065763605 -7 Left 1065763601 10:29006514-29006536 CCTCCCTTAGTTGGTAACCAGAG No data
Right 1065763605 10:29006530-29006552 ACCAGAGGTCTCAATGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065763601 Original CRISPR CTCTGGTTACCAACTAAGGG AGG (reversed) Intergenic