ID: 1065764676

View in Genome Browser
Species Human (GRCh38)
Location 10:29016908-29016930
Sequence CTCAAGACACAGATGTACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065764676_1065764678 8 Left 1065764676 10:29016908-29016930 CCTTAGTACATCTGTGTCTTGAG No data
Right 1065764678 10:29016939-29016961 AAGTGATATCTCTACTAAGATGG No data
1065764676_1065764679 29 Left 1065764676 10:29016908-29016930 CCTTAGTACATCTGTGTCTTGAG No data
Right 1065764679 10:29016960-29016982 GGATAACTTCAGATATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065764676 Original CRISPR CTCAAGACACAGATGTACTA AGG (reversed) Intergenic
No off target data available for this crispr