ID: 1065766893

View in Genome Browser
Species Human (GRCh38)
Location 10:29038659-29038681
Sequence CAATTTTGGACCACAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065766893_1065766896 11 Left 1065766893 10:29038659-29038681 CCTTGCTCTGTGGTCCAAAATTG No data
Right 1065766896 10:29038693-29038715 TATTTAGTATTTACCAGGCATGG No data
1065766893_1065766895 6 Left 1065766893 10:29038659-29038681 CCTTGCTCTGTGGTCCAAAATTG No data
Right 1065766895 10:29038688-29038710 TTATGTATTTAGTATTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065766893 Original CRISPR CAATTTTGGACCACAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr