ID: 1065768454

View in Genome Browser
Species Human (GRCh38)
Location 10:29054096-29054118
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065768454_1065768458 -2 Left 1065768454 10:29054096-29054118 CCCACGTGTGTGCAATGCAGGTG No data
Right 1065768458 10:29054117-29054139 TGTGTGCAAGGGACTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065768454 Original CRISPR CACCTGCATTGCACACACGT GGG (reversed) Intergenic
No off target data available for this crispr