ID: 1065770886

View in Genome Browser
Species Human (GRCh38)
Location 10:29077334-29077356
Sequence CTAATTCAGCAAGTATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065770886_1065770887 9 Left 1065770886 10:29077334-29077356 CCAATAAATACTTGCTGAATTAG No data
Right 1065770887 10:29077366-29077388 TGAGACAGACATAAAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065770886 Original CRISPR CTAATTCAGCAAGTATTTAT TGG (reversed) Intergenic
No off target data available for this crispr