ID: 1065771116

View in Genome Browser
Species Human (GRCh38)
Location 10:29079629-29079651
Sequence TATGCAGGACTGACAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065771116_1065771118 -10 Left 1065771116 10:29079629-29079651 CCTCTTTTTGTCAGTCCTGCATA No data
Right 1065771118 10:29079642-29079664 GTCCTGCATAGGAGATAGTGAGG No data
1065771116_1065771120 13 Left 1065771116 10:29079629-29079651 CCTCTTTTTGTCAGTCCTGCATA No data
Right 1065771120 10:29079665-29079687 AATTTTACCTGTAGATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065771116 Original CRISPR TATGCAGGACTGACAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr