ID: 1065773247

View in Genome Browser
Species Human (GRCh38)
Location 10:29096879-29096901
Sequence GTAGACAAGAAGGATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065773247_1065773252 -3 Left 1065773247 10:29096879-29096901 CCATCCCCATCCTTCTTGTCTAC No data
Right 1065773252 10:29096899-29096921 TACTCTCTTACTGACCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065773247 Original CRISPR GTAGACAAGAAGGATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr