ID: 1065775517 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:29115997-29116019 |
Sequence | TCACGATTCTGGTGGCCGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065775517_1065775524 | 19 | Left | 1065775517 | 10:29115997-29116019 | CCTCCCGGCCACCAGAATCGTGA | No data | ||
Right | 1065775524 | 10:29116039-29116061 | TTTATAAATTACCCAGCCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065775517 | Original CRISPR | TCACGATTCTGGTGGCCGGG AGG (reversed) | Intergenic | ||