ID: 1065775517

View in Genome Browser
Species Human (GRCh38)
Location 10:29115997-29116019
Sequence TCACGATTCTGGTGGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065775517_1065775524 19 Left 1065775517 10:29115997-29116019 CCTCCCGGCCACCAGAATCGTGA No data
Right 1065775524 10:29116039-29116061 TTTATAAATTACCCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065775517 Original CRISPR TCACGATTCTGGTGGCCGGG AGG (reversed) Intergenic